Compounds and methods for reducing snca expression

a technology of compound and method, applied in the field of compound and method for reducing snca expression, can solve the problems of lack of acceptable options for treating neurodegenerative diseases, and achieve the effects of reducing neurodegeneration, improving motor function, and reducing alpha-synuclein aggregates

Pending Publication Date: 2022-10-06
IONIS PHARMA INC
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent provides methods for treating symptoms of various neurodegenerative diseases such as Parkinson's disease, dementia with Lewy bodies, and Alzheimer's disease. These methods may improve motor function, reduce symptoms associated with alpha-synuclein aggregation, neurodegeneration, and dementia. The patent discusses the use of certain compounds and techniques for reducing inflammation, promoting cell survival, and protecting against oxidative stress. Overall, this patent offers new ways to potentially treat these debilitating diseases and improve the quality of life for patients.

Problems solved by technology

Currently there is a lack of acceptable options for treating neurodegenerative disease such as Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher's disease and Alzheimer's disease.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Compounds and methods for reducing snca expression
  • Compounds and methods for reducing snca expression
  • Compounds and methods for reducing snca expression

Examples

Experimental program
Comparison scheme
Effect test

example 1

5-8-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

[0381]Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0382]Cultured SH-SY5Y cells at a density of 20,000 cells per well were transfected using electroporation with 7,000 nM concentration of modified oligonucleotide or no modified oligonucleotide for untreated controls. After approximately 24 hours, RNA was isolated from the cells and SNCA mRNA levels were measured by quantitative real-time PCR Human primer probe set RTS2621 (forward sequence ACGAACCTGAAGCCTAAGAAATATCT, designated herein as SEQ ID NO: 11; reverse sequence GAGCACTTGTACAGGATGGAACAT, designated herein as SEQ ID NO: 12; probe sequence TGCTCCCAAGTTTCTTGAGATCTGCTGACA, designated herein as SEQ ID: 13) was used to measure mRNA levels. SNCA m...

example 2

4-9-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

[0385]Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested as described in Example 1 for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0386]The modified oligonucleotides marked with an asterisk (*) target the amplicon region of the primer probe set. Additional assays may be used to measure the potency and efficacy of oligonucleotides targeting the amplicon region. Compound No. 387978, previously disclosed in WO 2012 / 068405 was also tested and is a comparator oligonucleotide. Compound No. 387978 is a 5-10-5 MOE gapmer wherein each internucleoside linkage is a phosphorothioate internucleoside linkage and each cytosine residue is a 5-methyl cytosine.

[0387]The modified oligonucleotides in tables 7-13 are 4-9-4 MOE and cEt gapmers. The gapmers are 17 nucleob...

example 3

4-9-4 MOE and cEt Gapmers with Mixed Internucleoside Linkages on Human SNCA In Vitro, Single Dose

[0389]Modified oligonucleotides complementary to a human SNCA nucleic acid were designed and tested as described in Example 1 for their effect on SNCA mRNA in vitro. The modified oligonucleotides were tested in a series of experiments that had similar culture conditions.

[0390]The modified oligonucleotides in tables 14-23 are 4-9-4 MOE and cEt gapmers. The gapmers are 17 nucleobases in length, wherein the central gap segment comprises nine 2′-deoxynucleosides and is flanked by wing segments on both the 5′ end on the 3′ end comprising two 2′-MOE nucleosides and two cEt nucleosides. The sugar motif for the gapmers is (from 5′ to 3′): eekkdddddddddkkee; wherein ‘d’ represents a 2′-deoxyribose sugar; ‘e’ represents a 2′-MOE modified sugar; and ‘k’ represents a cEt modified sugar. All cytosine residues throughout each gapmer are 5-methyl cytosines. The internucleoside linkages are mixed phosph...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
lengthaaaaaaaaaa
pharmaceutical compositionaaaaaaaaaa
Login to View More

Abstract

Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of SNCA mRNA in a cell or animal, and in certain instances reducing the amount of alpha-synuclein protein in a cell or animal Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease. Such symptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline and dementia. Such neurodegenerative diseases include Parkinson's disease, dementia with Lewy bodies, diffuse Lewy body disease, pure autonomic failure, multiple system atrophy, neuronopathic Gaucher's disease and Alzheimer's disease.

Description

SEQUENCE LISTING[0001]The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0289USC1SEQ_ST25.txt, created on Nov. 8, 2021, which is 712 KB in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.FIELD[0002]Provided are compounds, methods, and pharmaceutical compositions for reducing the amount or activity of alpha-synuclein (SNCA) mRNA in a cell or animal, and in certain instances reducing the amount of alpha-synuclein protein in a cell or animal Such compounds, methods, and pharmaceutical compositions are useful to ameliorate at least one symptom or hallmark of a neurodegenerative disease. Such symptoms and hallmarks include motor dysfunction, aggregation of alpha-synuclein, neurodegeneration, cognitive decline and dementia. Such neurodegenerative diseases include Parkinson's disease, dementia with Lewy bodies, diffuse Le...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N15/113A61P25/16
CPCC12N15/113A61P25/16C12N2310/11C12N2310/31C12N2310/315C12N2310/322C12N2310/341C12N2310/351A61K31/7115A61K31/712A61K31/7125A61P25/00A61P25/28C07H21/04C12N2310/3231C12N2310/3341C12N2310/346C12N2320/30C12N2310/321C12N2310/3525
InventorKORDASIEWICZ, HOLLYSINGH, PRIYAMFREIER, SUSAN M.COLE, TRACY A.
OwnerIONIS PHARMA INC