GAS57 mutant antigens and GAS57 antibodies
a technology of mutant antigens and antibodies, applied in the field of immunology and vaccinology, can solve problems such as hammering its use in a vaccine composition
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Purified Wild-Type Recombinant GAS57 Cleaves IL-8 and Other CXC Cytokines
[0329]Wild-type GAS57 was expressed and purified from E. coli either as His-tagged or untagged protein. All variants were expressed without the N-terminal leader sequence and without the C-terminal transmembrane domain (see SEQ ID NOS:78 and 79). In detail, the gas57 gene was PCR amplified from M1_SF370 genome using the following primers:
[0330]
(SEQ ID NO: 69)57F,GTGCGT GCAGATGAGCTAAGCA(SEQ ID NO: 70)57R,GCGT GGCTTTTGCTGTTGCTGAGGT(SEQ ID NO: 71)57stopR,GCGT TTAGGCTTTTGCTGTTGCTGAGGT.
[0331]Primers 57F and 57R were used to obtain the His-tagged form, while primers 57F and 57stopR were used to obtain the untagged form. The PCR products were digested with NdeI-XhoI and ligated respectively with pET21b+ and pet24b+ cut with the same enzymes.
[0332]E. coli BL21(DE3) electrocompetent cells were transformed with the ligation reactions. Kanamycin resistant colonies carrying the plasmid with the correct insert (pET21—57his ...
example 2
Preparation of GAS57 Mutants
[0336]By comparison with C5a protease (FIG. 2), three amino acids in the GAS57 were identified that putatively constitute the catalytic site of the protease: D151, H279 and S617. In order to obtain an inactive form of the enzyme, nucleotide substitutions resulting in amino acid changes D151A and / or S617A were introduced in the GAS57 coding sequence by Splicing by Overlapping Extension PCR (SOE-PCR).
[0337]Substitution D151A
[0338]Three PCR reactions were carried out:
[0339]
PCR reactionTemplatePrimersPCR1 genomic57F, GTGCGT GCAGATGAG(360SF370CTAAGCA; SEQ ID NO: 69bps)57mutDR1, CCCTGTGGCAATAACTGCGAC; SEQ ID NO: 72PCR2genomic57mutDF1, cgCAGTTATTGcCACAGGGAT,(910SF370SEQ ID NO: 73bp)57mutSalR, CTGACTGA AGACTCTGAATAGATG, SEQ ID NO: 74PCR3PCR1,57F(1270PCR257mutSalRbps)
[0340]PCR product 3 was then digested with Nde-Sal and introduced in pET21—57his digested with the same enzymes. Clones containing the correct in-frame substitutions (pET21—57his_D151A) were selected ...
example 3
Point Mutation D151A Results in Inactivation of GAS57 Proteolytic Activity
[0348]GAS57 mutant D151A was expressed as a recombinant His-tagged protein. Two types of assays demonstrated that this mutant has lost the ability to cleave IL-8.
[0349]SDS-PAGE
[0350]IL-8 was incubated with wild-type GAS57 or the GAS57 mutant D151A. The incubation mixtures were loaded on SDS-PAGE and revealed by silver staining. The results are shown in FIG. 3. Wild-type GAS57 (lanes 2 and 3) released two bands: 8 kDa (active form) and 6 kDa (inactive cleaved IL-8). In contrast, the GAS57 D151A mutant released only one band, which corresponded to uncleaved IL-8, as in the control reaction (without enzyme).
[0351]ELISA
[0352]IL-8 was incubated with wild-type GAS57 or the GAS57 mutant D151A at three different concentrations, and the incubation mixtures were tested for the presence of uncleaved IL-8 using an antibody which is specific for the cytokine but which is unable to recognize the cleaved inactive form. The r...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More