LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof

A primer combination and primer set technology, applied in recombinant DNA technology, microbial measurement/testing, biochemical equipment and methods, etc., can solve problems such as time-consuming, poor specificity, and low throughput

Active Publication Date: 2018-01-05
CAPITALBIO CORP
View PDF4 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Traditional methods for detecting pathogenic bacteria such as isolation culture, morphological observation, physiology and biochemistry, and selective medium have the characteristics of low sensitivity, poor specificity, heavy workload, long time-consuming, and low throughput.
The microbial culture method takes a long time and needs 3-4 days to produce a test report, which cannot meet the purpose of timely treating bovine mastitis against pathogens
Immunological techniques (such as ELISA) have high sensitivity, but are prone to contamination and often have false positives
Usually, a specific primer for one pathogenic bacteria and one specific primer is used to check the specific pathogen. Although it can achieve the purpose of rapid, correct and convenient diagnosis of a single bacterium, when the pathogen is not named, it needs a variety of different primers for detection. test, which is clearly not ideal for the complexity of pathogens and the diversity of PCR programs
PCR has the disadvantages of long detection time, easy contamination, and high false positive rate, which limits its application.
There are many technical problems in the above technologies and methods for the detection of pathogenic microorganisms, and in practice, due to the wide variety of pathogenic microorganisms, it is difficult for the above methods to efficiently detect multiple pathogenic microorganisms at the same time

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof
  • LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof
  • LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0187] Embodiment 1, the preparation of kit

[0188] The kit consists of six LAMP primer sets, each for the detection of one infectious agent of cow mastitis.

[0189] The primer set for detecting Mycoplasma bovis is as follows (5'→3'):

[0190] Outer primer F3 (SEQ ID NO: 1): GGACGACGTCAAATCATCA;

[0191] Outer primer B3 (SEQ ID NO: 2): CCGTAGCGTAGCTGATCT;

[0192] Internal primer FIP (SEQ ID NO: 3): CCATGTCACCACTTCGCTTTCTCTTCCTCTTACGAGTGGGGCTA;

[0193] Internal primer BIP (SEQ ID NO: 4): CAAACCTCAAAAAACCGTTCTCAGACGATTACTAGCGATTCCGACT;

[0194] Loop primer LF (SEQ ID NO: 5): ACCGTCCATTGTAGCACGTGTG;

[0195] Loop primer LB (SEQ ID NO: 6): AAGTCTGCAACTCGACTTCATG.

[0196] The primer set used to detect Staphylococcus aureus is as follows (5'→3'):

[0197] Outer primer F3 (SEQ ID NO: 7): GCAACTGAAACAACAGAAGC;

[0198] Outer primer B3 (SEQ ID NO: 8): TTTTGTGTTGGGCGAGC;

[0199] Internal primer FIP (SEQ ID NO: 9): TCACGGATACCTGTACCAGCATCTCTATGGTCCGAGACCGCAATT;

[0200] In...

Embodiment 2

[0232] Embodiment 2, specificity

[0233] Test sample 1: Mycoplasma bovis ( 25523 TM ).

[0234] Test sample 2: Staphylococcus aureus (CVCC 545).

[0235] Test sample 3: Streptococcus agalactiae (CVCC 586).

[0236] Test sample 4: Streptococcus pyogenes (CGMCC1.8868).

[0237] Test sample 5: Corynebacterium bovis (CVCC CAU0107).

[0238] Test sample 6: Staphylococcus epidermidis ( 12228 TM ).

[0239] Each sample to be tested carries out the following steps respectively:

[0240] 1. Extract the genomic DNA of the sample to be tested.

[0241] 2. Using the genomic DNA extracted in step 1 as a template, each primer set prepared in Example 1 was used to perform loop-mediated isothermal amplification.

[0242] Reaction system (10 μL): 7.0 μL reaction solution (product of Boao Bio Group Co., Ltd., catalog number CP.440020), 1 μL primer mixture, 1 μL template DNA (5pg-50pg), make up to 10 μL with water. The primer mixture is the mixture of each primer in the primer set....

Embodiment 3

[0252] Embodiment 3, sensitivity

[0253] Test sample 1: Mycoplasma bovis ( 25523 TM ).

[0254] Test sample 2: Staphylococcus aureus (CVCC 545).

[0255] Test sample 3: Streptococcus agalactiae (CVCC 586).

[0256] Test sample 4: Streptococcus pyogenes (CGMCC1.8868).

[0257] Test sample 5: Corynebacterium bovis (CVCC CAU0107).

[0258] Test sample 6: Staphylococcus epidermidis ( 12228 TM ).

[0259] 1. Extract the genomic DNA of the sample to be tested, and perform gradient dilution with sterile water to obtain each dilution.

[0260] 2. Using the dilution obtained in step 1 as a template, the primer sets prepared in Example 1 were used to perform loop-mediated isothermal amplification.

[0261] When the sample to be tested is the sample to be tested 1, the loop-mediated isothermal amplification is performed using primer set I. When the sample to be tested is the sample to be tested 2, loop-mediated isothermal amplification is performed using primer set II. When...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP primer combination for detecting 6 infectious pathogens of dairy cow mastitis and application thereof. The invention first provides a primer combination consisting of 36 DNA molecules shown in sequence 1 to sequence 36. The primer combination can be used for detecting whether a to-be-detected bacterium is Mycoplasma bovis, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus pyogenes, Corynebacterium bovis or Staphylococcus epidermidis, and can be used for detecting whether a to-be-detected sample contains Mycoplasma bovis and / or Staphylococcus aureusand / or Streptococcus agalactiae and / or Streptococcus pyogenes and / or Corynebacterium bovis and / or Staphylococcus epidermidis. The primer combination provided by the invention is used for identifying and detecting the 6 infectious pathogens of dairy cow mastitis, has high specificity and high sensitivity, and can realize simple, rapid and accurate detection, thus having great popularization value.

Description

technical field [0001] The invention relates to a combination of LAMP primers for detecting six kinds of infectious pathogens of cow mastitis and its application. Background technique [0002] Mastitis in dairy cows is inflammation of the lactating tissue in the milk area, usually caused by bacterial infection, and occurs in one or more milk areas, resulting in reduced milk production, cessation of milk production, and changes in milk quality. Dairy mastitis affects 25-50% of dairy cows every year and is the most costly disease in dairy farming. [0003] Cow mastitis is caused by a variety of non-specific pathogenic microorganisms. At present, there are about 150 kinds (including cocci, bacilli, mycoplasma, fungi or yeasts, viruses, etc.), among which the more common ones can be divided into infectious pathogens and non-communicable pathogens. According to reports, the annual loss caused by cow mastitis in the world is 2 billion US dollars in the United States, 267 million...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/689C12Q1/6844C12Q1/14C12Q1/04
Inventor张岩王玉邢婉丽程京
OwnerCAPITALBIO CORP