Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence
A technology for Listeria monocytogenes and monocytogenes, applied in the field of primers and probe sequences for detecting nucleotide fragments of Listeria monocytogenes, capable of solving non-specific amplification and immature technology , PCR product contamination and other issues
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0011] 1. Design of primers and probes: Through comparative analysis of all known L. monocytogenes genome sequences, a highly conserved segment (L. monocytogenes iap gene) with no secondary structure was selected, and multiple pairs were designed. For primers and probes, the length of the primers is generally about 20 bases, and there is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:
[0012] Upstream primer LMF1420: CTGAATCTCAAGCAAAACCTGGT
[0013] Downstream primer LMR1593: CGCGACCGAAGCCAACTA
[0014] Probe LM-p1: ATACGATAACATCCACGGCTCTGGCTGG
[0015] 2. Establishment and optimization of the reaction system: The target region template used in the establishment and optimization of the reaction system was obtained by the following method: take the standard strain of Listeria monocytogenes and culture it for 48 hours after recovery, and take 1ml of the culture solution for 10-fold serial dilution ,...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap