Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence

A technology for Listeria monocytogenes and monocytogenes, applied in the field of primers and probe sequences for detecting nucleotide fragments of Listeria monocytogenes, capable of solving non-specific amplification and immature technology , PCR product contamination and other issues

Inactive Publication Date: 2008-06-18
TAITAI GENOMICS
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The gene chip method has high detection efficiency, but the technology is immature, the false positive rate and false negative rate are difficult to control, and the cost is high, and it is still in the research stage
Ordinary PCR method is mature in technology and was first used in the detection of food-borne pathogenic bacteria. However, post-processing of PCR products is required, which can easily lead to PCR product contamination, and also has certain non-specific amplification.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer for detecting Listern nucleotide segment of monocellular hyperplasia and probe sequence

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0011] 1. Design of primers and probes: Through comparative analysis of all known L. monocytogenes genome sequences, a highly conserved segment (L. monocytogenes iap gene) with no secondary structure was selected, and multiple pairs were designed. For primers and probes, the length of the primers is generally about 20 bases, and there is no complementary sequence between and within the primers. The optimal primer and probe sequence combinations are as follows:

[0012] Upstream primer LMF1420: CTGAATCTCAAGCAAAACCTGGT

[0013] Downstream primer LMR1593: CGCGACCGAAGCCAACTA

[0014] Probe LM-p1: ATACGATAACATCCACGGCTCTGGCTGG

[0015] 2. Establishment and optimization of the reaction system: The target region template used in the establishment and optimization of the reaction system was obtained by the following method: take the standard strain of Listeria monocytogenes and culture it for 48 hours after recovery, and take 1ml of the culture solution for 10-fold serial dilution ,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention is PCR proliferation primer and probe sequence for detecting nucleotide segment of monocellular hyperplasia Listeria. The primer sequence includes the primer pair comprising upstream primer sequence LMF1420 of CTGAATCTCAAGCAAAACCTGGT and downstream primer sequence LMR1593 of CGCGACCGAAGCCAACTA, as well as 10 bases extending in 5' end direction and 10 bases extending in 3' end direction of upstream primer LMF1420 and 9 bases extending in 3' end direction and 5 bases extending in 5' end direction of downstream primer LMR1593. The probe sequence includes probe LM-p1 sequence ATACGATAACATCCACGGCTCTGGCTGG, 9 bases extending in the 3' end direction and 10 bases extending in the 5' end direction.

Description

technical field [0001] The invention relates to a primer and a probe sequence for detecting the nucleotide fragment of Listeria monocytogenes. Background technique [0002] Listeria monocytogenes (hereinafter referred to as Listeria monocytogenes) is a common pathogenic bacterium in imported and exported food, and it is also the main pathogenic bacterium that causes food poisoning and foodborne diseases. It can cause meningitis, encephalitis, and Inflammation, sepsis, endocarditis, miscarriage, abscess and local purulent damage, and can cause miscarriage, stillbirth and other diseases in pregnant women. The mortality rate of the patients can reach 30-70%. The World Health Organization (WTO) pointed out in the report on food poisoning caused by Listeria monocytogenes: 4-8% of aquatic products, 5-10% of milk and milk products, more than 30% of meat products, and more than 15% of poultry All meat products were contaminated by the bacteria. Since the bacteria can also grow an...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
Inventor 肖性龙林镜中
Owner TAITAI GENOMICS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com