46 results about "Karyocytomegaly" patented technology

Food products, such as precooked meats, sausages, and the like are microbially decontaminated in their cooking packages to remove surface microorganism contamination from the packages. The cooking packages are removed and the food products optionally subjected to further processing, such as slicing, and then packaged in aseptic packaging. The microbial decontamination step, further processing and packaging are carried out in a clean room which is maintained to a high level of sterilization or disinfection to minimize or eliminate contamination of the food products with pathogenic microorganisms such as Listeria Monocytogenes. The food products thus leave the packaging plant with a much higher assurance of food safety than is found in a conventional packaging plant.

The present invention relates to virulent (lytic) Listeria monocytogenes phage from the Myoviridae family, preferably P100, alone or in combination with other virulent phages. P100 and the endolysin from P100 can be administered to food products, to the components that will be added to food products, and/or to the infrastructure of the food processing plants within which such food products are processed, or the containers or wraps in which such foods are stored and/or shipped, in order to reduce Listeria monocytogenes contamination. P100 can also be used in the present invention to identify Listeria monocytogenes bacteria present on (or within) foodstuffs, as well as those Listeria monocytogenes bacteria present in the equipment or the general environment of the food processing plants in which the foodstuffs are being processed and in animals infected with Listeria monocytogenes. The phage and the endolysin of the present invention can also be used to treat animals infected with Listeria monocytogenes. P100 will kill the bacteria that are within its host range with great efficiency and will propagate to high titer thereon. P100 can be combined with other lytic phage, and/or with other antimicrobial agents to reduce or eliminate Listeria.

The invention aims at providing an LAMP method for rapidly detecting the real-time turbidity Listeria monocytogenes, for making up the defects of the prior art. The method comprises the following step: firstly, providing an LAMP primer group for detecting Listeria monocytogenes, wherein the nucleotide sequences of the LAMP primer group are as shown in SEQ ID NO:1-4. A set of LAMP primers are designed aiming at the hemolysin gene of the Listeria monocytogenes, a real-time turbidity instrument is adopted to detect the Listeria monocytogenes, and the specificity and the sensitivity of the method are verified, so that a rapid, specific and sensitive Listeria monocytogenes LAMP detection method is established.

The invention discloses a method of loop-mediated isothermal amplification (LAMP) for detecting Listeria monocytogenes. At present, the traditional detection method for microorganisms has complex operation, besides, the detection time is longer with 5-15 days of culture and identification time required generally and the requirement of rapid detection cannot be met on time. The method comprises the following: pretreatment, detection process, result detection and result judgment, target gene of the Listeria monocytogenes is selected (the GenBank accession number AF532235), two pairs of primers are designed, the LAMP gene amplification is carried out for the nucleic acid of the Listeria monocytogenes through providing a specific primer group, a specific gene fragment is detected whether to exist in the sample, and further the Listeria monocytogenes are determined whether to exist in the sample. The method is used in detection of foodborne bacterial pathogens.

The invention discloses a method for detecting viable Listeria monocytogene, relating to a method for detecting Listeria. The invention solves the problem that the prior method for detecting viable Listeria monocytogenes is easy to produce false positive. The method for detecting viable Listeria monocytogenes is carried out as following steps: after extracting bacterial sludge from articles to be detected, extracting RNA to implement retrotransposon and real time PCR; accordingly, a collection of illustrative plates which are capable of determining whether the articles contain viable Listeria monocytogenes or not. The method has the advantages of high sensitivity, good specificity, simple operation, and comparatively short period. The method meets the requirements of pathogen rapid detection in food industry.

Methods, formulations and kits containing levulinate or levulinic acid are disclosed that have potent and unexpected properties to inhibit the growth and/or proliferation of Listeria monocytogenes bacteria in a food sample.

The invention discloses a nucleotide sequence for detecting listeria monocytogenes and a detection method and a detection kit, wherein the nucleotide sequence is expressed as SEQ ID NO. 1, the detection method is as follows: firstly, extracting the gene group DNA of the sample to be detected; secondly, taking the gene group DNA as the template, mixing with the specific primer Lm16, PCR buffer solution, MgCl2 solution, deoxidation nucleoside triphosphate mixture and Taq-DNA polymerase for preparing the PCR reaction system, carrying out the PCR reaction; finally, detecting whether the PCR product is the single amplification product, the size of which is 1623bp. The kit comprises the specific primer, PCR buffer solution, MgCl2 solution, deoxidation nucleoside triphosphate mixture and Taq-DNA polymerase. The kit can effectively detect the listeria monocytogenes in the food, and the detection sensitivity for the bacteria is high, the specificity is good and the antijamming capability is strong.

Embodiments of the disclosure relate to isolated nucleic acid sequences, methods of use thereof, and workflows for detection of several Listeria species in a sample, particularly in a food or environmental sample. Embodiments of the disclosure may also be used to detect one or more species or strains of Listeria from each other, for example L. grayi may be detected independently of other Listeria spp. Some embodiments also describe a duplexed assay that can detect L. monocytogenes, L. innocua, L. welshimeri, L. seelgeri, L. marthii (formerly incertae-sedis), L. ivanovii, and L. grayi. Kits for detection of Listeria are also described. In some embodiments, methods and kits of the disclosure may comprise a TAQMAN® assay. In some embodiments, 0.2-2 cfu of Listeria spp. are detected using the compositions, methods and kits after a 24-28 hour enrichment period.

The invention discloses polynucleotide, a method and a kit for detecting listeria monocytogenes. Specifically, the invention discloses polynucleotide, which can be used as a standard molecule in realtime fluorescent PCR detection of listeria monocytogenes, and DNA constructs (LY01 and LY02). The provided plasmid standard molecule can solve the problem that realtime fluorescence PCR detection of listeria monocytogenes is lack of standard substances, and moreover, can guarantee the comparability of the detection results of realtime fluorescence PCR detection. A reliable quality control method is provided for the realtime fluorescence PCR detection of listeria monocytogenes.

The invention discloses a Listeria monocytogenes enzyme-linked immunosorbent assay kit. The kit contains two monoclonal antibodies which can be specifically bonded to the Listeria monocytogenes, wherein one monoclonal antibody is 1B4E7A6C9 specially used for capturing the antibody, and other monoclonal antibody is 6D4H7C8B6 used for detecting the antibody. The kit is proved to be capable of detecting the Listeria monocytogenes specifically in a high-efficiency manner and having no cross reaction with other 68 common pathogenic bacteria through substantive tests, and therefore, the kit has good performances on detecting the pathogenic bacteria.

The invention belongs to the field of microbiological detection and in particular relates to a method for detecting Listeria monocytogenes and two Listeria monocytogenes resisting monoclonal antibodies generated in the same monoclonal antibody preparation process for the method. The monoclonal antibodies can be specifically bonded with the Listeria monocytogenes and is generated by mouse hybridoma cell line 6D4H7C8B6, CGMCC No.8002 or 1B4E7A7C9, CGMCC No.8765. The invention also provides application of the Listeria monocytogenes resisting monoclonal antibodies.

The invention discloses a method for enriching and separating listeria monocytogenes (Listeria monocytogenes, Lm), provides a basis for subsequent research on target bacteria and relates to the technical field of biology. The method comprises the following steps: performing covalent coupling on a dendrimer and an antibody, coating a long-chain biotin molecule on the antibody-modified dendrimer, capturing the target bacteria in a sample solution through the dendrimer modified by the antibody and the long-chain biotin, identifying streptavidin-modified nano magnetic beads and coupling the long-chain biotin dendrimer in the sample solution, separating and suspending the captured bacteria, wherein suspension can be directly analyzed later. Compared with the traditional bacteria magnetic separation method, the method is suitable for performing magnetic separation on the bacteria in a complex substrate, and the separation efficiency of target bacteria in the sample is improved.

The invention provides a fluorescent quantitative PCR (polymerase chain reaction) reagent kit for detecting Listeria monocytogenes, which comprises a pair of primers, a probe and a positive quantitative template. The sequences of the primers and the sequence of the probe are respectively SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, the positive quantitative template is pMD 18-T recombinant plasmid with the sequence of SEQ ID No.4, the reagent kit further can comprise fluorescent quantitative polymerase and reference dye, and application of the reagent kit to detecting the Listeria monocytogenes in clinical samples is also provided. Experimental results show that the fluorescent quantitative PCR reagent kit for detecting the Listeria monocytogenes is high in specificity and sensitivity, simple in composition and convenient in operation, and can be used for quickly detecting the Listeria monocytogenes.

An ADP-ribosylating toxin from Listeria monocytogenes is disclosed, together with mutant toxins and uses therefor. There is only a low level of sequence identity between this toxin and known toxins such as the iota toxin from Clostridium perfringens.

A method using a liquid phase chip to detect mononuclear cell proliferation listeria belongs to the field of immunity technology and food sanitation detection technology. The invention aims to provide the method using the liquid phase chip to detect mononuclear cell proliferation listeria, so as to realize rapid detection of mononuclear cell proliferation listeria. In the invention, the liquid phase chip is prepared and then applied to detect mononuclear cell proliferation listeria. Compared with other detection methods, the method using the liquid phase chip to detect mononuclear cell proliferation listeria has advantage of high two-way throughput of detection sample amount and detection items (a large amount of samples can be detected in items as many as 96), and has the characteristics of good flexibility, high sensitivity, good SNR (signal to noise ratio), convenience for operation, wide standard curve range, wide applicable range and the like. The liquid phase chip technology, as an advanced service platform of bioinformatics, has wide applicable prospect in fields like clinical diagnosis, veterinarian communicable disease diagnosis, food microorganism detection and so on.

The present invention is PCR proliferation primer and probe sequence for detecting nucleotide segment of monocellular hyperplasia Listeria. The primer sequence includes the primer pair comprising upstream primer sequence LMF1420 of CTGAATCTCAAGCAAAACCTGGT and downstream primer sequence LMR1593 of CGCGACCGAAGCCAACTA, as well as 10 bases extending in 5' end direction and 10 bases extending in 3' end direction of upstream primer LMF1420 and 9 bases extending in 3' end direction and 5 bases extending in 5' end direction of downstream primer LMR1593. The probe sequence includes probe LM-p1 sequence ATACGATAACATCCACGGCTCTGGCTGG, 9 bases extending in the 3' end direction and 10 bases extending in the 5' end direction.

The invention discloses a specific antibody coated PCR (polymerase chain reaction) tube and an immune PCR detection kit which are used for detecting Listeria monocytogenes. The PCR reaction tube is precoated with monoclonal antibodies which can specifically enrich Listeria monocytogenes in samples. The detection kit can quickly, accurately and sensitively detect the Listeria monocytogenes from the samples like food, and the sensitivity can be 10<3>-10<4>cfu/ml and is increased by 10-100 times compared with the sensitivity of the conventional PCR. The PCR reaction tube and the immune PCR detection kit have the advantages that immunology and a molecular biological method are organically combined into a whole, enrichment and detection of Listeria monocytogenes in the samples can be realized in one PCR tube, operation is easy, cost is low, detection is quick and results are accurate.