Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method of loop-mediated isothermal amplification (LAMP) for detecting Listeria monocytogenes

A mononuclear cell proliferation, ring-mediated constant temperature technology, applied in biochemical equipment and methods, microbial measurement/testing, etc., can solve the problems of difficult promotion and use, high equipment investment, poor sensitivity, etc., and achieve easy detection and operation , less investment in equipment and high sensitivity

Inactive Publication Date: 2010-06-23
INSPECTION & QUARANTINE TECH CENT OF HEILONGJIANG ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
View PDF0 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Immunological methods are simple and fast, but have poor sensitivity and high false positives; molecular biology techniques are simple and fast, with high sensitivity, but require high equipment investment and are not easy to popularize and use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] The loop-mediated constant temperature amplification method detects Listeria monocytogenes, and its composition includes: pretreatment, selection of target genes of Listeria monocytogenes, detection process, result detection, result judgment, selection of Listeria monocytogenes The target gene of Tetrabacterium (GenBank accession number: AF532235), design 2 pairs of primers:

[0026] The inner primer is: FIP: TTAGGCGCAGGTGTAGTTGC CTGCTGCAGAAACAAAAACTGAA

[0027] BIP: GATCAAAATGCTACTACACACGCTGCCGTATTTTACGGATAAAGCCCA

[0028] The outer primer is: F3: ACACAAGAAGTGAAAAAAGAAAC

[0029] B3: ACATAATGTCTTGAACAGAAACA

[0030] By providing a specific primer set, LAMP gene amplification is performed on the nucleic acid of Listeria monocytogenes to detect whether there is a specific gene fragment in the sample, and then determine whether there is Listeria monocytogenes in the sample.

Embodiment 2

[0032] The loop-mediated constant temperature amplification method detects Listeria monocytogenes, and its composition includes: pretreatment, detection process, result detection, and result judgment. The detection process is to mix 22.5 μ LAMP reaction solution, 0.5 μ L Bst enzyme, DNA ( monocytogenes) into a clean 1.5mL centrifuge tube, mix evenly, and centrifuge at 2000r / min for 10sec, add 22.5μL of the above reaction solution to a group of reaction tubes, and put them in the PCR reaction tubes in sequence. Add 2 μL each of the negative control, the template to be tested, and the positive control, tightly cap the tube and mark it, and place it at 65°C for 60 minutes to react.

Embodiment 3

[0034] The loop-mediated constant temperature amplification method detects Listeria monocytogenes, and the pretreatment is to melt the loop-mediated constant temperature amplification LAMP reaction solution at room temperature before use, shake and mix it at room temperature, and then heat it at 2000r / min. Centrifuge at a rotational speed for 10 sec, and then centrifuge at a rotational speed of 2000 r / min for 10 sec after the rest are melted at room temperature.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method of loop-mediated isothermal amplification (LAMP) for detecting Listeria monocytogenes. At present, the traditional detection method for microorganisms has complex operation, besides, the detection time is longer with 5-15 days of culture and identification time required generally and the requirement of rapid detection cannot be met on time. The method comprises the following: pretreatment, detection process, result detection and result judgment, target gene of the Listeria monocytogenes is selected (the GenBank accession number AF532235), two pairs of primers are designed, the LAMP gene amplification is carried out for the nucleic acid of the Listeria monocytogenes through providing a specific primer group, a specific gene fragment is detected whether to exist in the sample, and further the Listeria monocytogenes are determined whether to exist in the sample. The method is used in detection of foodborne bacterial pathogens.

Description

Technical field: [0001] The invention relates to a loop-mediated constant temperature amplification method for detecting Listeria monocytogenes. Background technique: [0002] At present, there are mainly standard methods, biochemical instrument method (API, VETEK), enzyme-linked fluorescence immunoassay (VIDAS), colloidal gold test paper method, PCR method, gene chip method, etc. for the detection of foodborne pathogens. In addition to the cumbersome operation, the traditional detection method of microorganisms also takes a long time. Generally, it takes 5-15 days for cultivation and identification, which cannot meet the requirements of rapid detection in terms of time. [0003] With the continuous development of modern science and technology, especially the continuous development of immunology, biochemistry, and molecular biology, people have created many rapid, simple, specific, and sensitive pathogen detection methods. Immunological methods are simple and fast, but poor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04
Inventor 李苏龙
Owner INSPECTION & QUARANTINE TECH CENT OF HEILONGJIANG ENTRY EXIT INSPECTION & QUARANTINE BUREAU OF P R C
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com