Method of loop-mediated isothermal amplification (LAMP) for detecting Listeria monocytogenes
A mononuclear cell proliferation, ring-mediated constant temperature technology, applied in biochemical equipment and methods, microbial measurement/testing, etc., can solve the problems of difficult promotion and use, high equipment investment, poor sensitivity, etc., and achieve easy detection and operation , less investment in equipment and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0025] The loop-mediated constant temperature amplification method detects Listeria monocytogenes, and its composition includes: pretreatment, selection of target genes of Listeria monocytogenes, detection process, result detection, result judgment, selection of Listeria monocytogenes The target gene of Tetrabacterium (GenBank accession number: AF532235), design 2 pairs of primers:
[0026] The inner primer is: FIP: TTAGGCGCAGGTGTAGTTGC CTGCTGCAGAAACAAAAACTGAA
[0027] BIP: GATCAAAATGCTACTACACACGCTGCCGTATTTTACGGATAAAGCCCA
[0028] The outer primer is: F3: ACACAAGAAGTGAAAAAAGAAAC
[0029] B3: ACATAATGTCTTGAACAGAAACA
[0030] By providing a specific primer set, LAMP gene amplification is performed on the nucleic acid of Listeria monocytogenes to detect whether there is a specific gene fragment in the sample, and then determine whether there is Listeria monocytogenes in the sample.
Embodiment 2
[0032] The loop-mediated constant temperature amplification method detects Listeria monocytogenes, and its composition includes: pretreatment, detection process, result detection, and result judgment. The detection process is to mix 22.5 μ LAMP reaction solution, 0.5 μ L Bst enzyme, DNA ( monocytogenes) into a clean 1.5mL centrifuge tube, mix evenly, and centrifuge at 2000r / min for 10sec, add 22.5μL of the above reaction solution to a group of reaction tubes, and put them in the PCR reaction tubes in sequence. Add 2 μL each of the negative control, the template to be tested, and the positive control, tightly cap the tube and mark it, and place it at 65°C for 60 minutes to react.
Embodiment 3
[0034] The loop-mediated constant temperature amplification method detects Listeria monocytogenes, and the pretreatment is to melt the loop-mediated constant temperature amplification LAMP reaction solution at room temperature before use, shake and mix it at room temperature, and then heat it at 2000r / min. Centrifuge at a rotational speed for 10 sec, and then centrifuge at a rotational speed of 2000 r / min for 10 sec after the rest are melted at room temperature.
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com