Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Multiple PCR detection kit for Listeria monocytogenes and Listeria illichii

A technology for monocytogenes and Listeria ii, applied in biochemical equipment and methods, measurement/inspection of microorganisms, microorganisms, etc., can solve cumbersome operations, Listeria monocytogenes and Listeria To solve the problems such as the complexity of bacteria detection, to achieve the effect of speeding up the detection speed, simple result judgment and high sensitivity

Active Publication Date: 2019-08-30
YANGZHOU UNIV
View PDF3 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The object of the present invention is to provide a multiple PCR detection kit for Listeria monocytogenes and Listeria eziri, which is used to solve the complex detection of Listeria monocytogenes and Listeria eziri in the prior art, cumbersome operation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Multiple PCR detection kit for Listeria monocytogenes and Listeria illichii
  • Multiple PCR detection kit for Listeria monocytogenes and Listeria illichii
  • Multiple PCR detection kit for Listeria monocytogenes and Listeria illichii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: Establishment of Multiplex PCR Detection Method for Listeria monocytogenes and Listeria izii

[0041] 1) Primers

[0042] Download the whole genome sequences of Listeria monocytogenes and Listeria izini from Genebank, and finally determine two specific target genes, lmo0601 and smcl, whose nucleotide sequences are shown in SEQ ID NO: 5 and 6, respectively shown. The conserved regions of the two target genes were found respectively, and primers were designed. The sequences of the two pairs of detection primers and the lengths of the corresponding amplification products are shown in Table 1.

[0043] Table 1 Primers for multiplex PCR detection of Listeria monocytogenes and Listeria izii

[0044]

[0045] SEQ ID NO: 5 (lmo0601 nucleotide sequence):

[0046] atgcataaacatcacttaagcaaaaaactatttttcgctggtttggtactatttattattggtgctatcggtgtagcattcacaatgaatacaggtaaaatgattgaaaaaggagaaccacttacaaaacagtgggacttatcaactgaaaatattaaaaaaattgctttttcttccgagcgtgatgcatcaattgaatgg...

Embodiment 2

[0071] The preparation of embodiment 2 kit

[0072] Gene lmo0601 detection primers and gene smcl detection primers were synthesized respectively, see Table 1 for details.

[0073] The above primers can be individually packaged or packaged separately, and the amount thereof can be used in a conventional amount known to those skilled in the art.

[0074] That is to say, the kit of the present invention may contain each set of primer pairs individually packaged above, or may contain a configured PCR detection mixture containing each set of primers.

[0075] Further, the above kit may also include other conventional reagents required for PCR, such as: one or more of common PCR reagents such as ddH2O, dNTP, PCR buffer, rTaq enzyme, sample genomic DNA extraction reagents, etc.

Embodiment 3

[0076] Example 3: Multiplex PCR Identification of Bacterial Cultures in Pork Samples

[0077] Using the multiplex PCR method established by the present invention, carry out multiplex PCR identification on 37 suspected Listeria strains isolated from pork samples recently, and at the same time refer to the biochemical identification method in GB 4789.30-2016 to conduct multiplex PCR identification results verify. The strain information is shown in Table 3.

[0078] Table 3 Listeria monocytogenes isolates in pork samples

[0079]

[0080]

[0081] The extraction method of bacterial strain genome template was carried out according to the method of conventional bacterial DNA extraction kit. Use the kit in Example 2 to amplify the DNA: Add 12.5 μL 2×Taq Master mix, 1 μL genomic DNA template, 10 μM primers lmo0601F, lmo0601R, smclF and smclR to each small PCR tube, and use ddH 2 O was made up to 25 μL and mixed, and a negative control was set at the same time. After the mul...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a multiple PCR detection kit for Listeria monocytogenes and Listeria illichii. The kit comprises a gene lmo0601 detection primer and a gene smcl detection primer. The inventionestablishes a multiple PCR method for rapidly detecting Listeria monocytogenes and Listeria illichii by using the two pairs of primers, and the method has the advantages of good specificity, high sensitivity, high detection speed, easy operation and simple result judgment.

Description

technical field [0001] The invention relates to a biological detection method, in particular to a multiplex PCR detection kit for Listeria monocytogenes and Listeria ishiri. Background technique [0002] Listeria monocytogenes is a very widespread gram-positive facultative intracellular parasite. Listeria contains two pathogenic bacteria, Listeria monocytogenes (Listeria monocytogenes, LM) and Listeria ivanovii (Listeria ivanovii, LV). Listeria monocytogenes is an important food-borne zoonotic pathogen, which mainly causes meningitis, gastroenteritis, sepsis and abortion after infecting humans and animals, with a mortality rate as high as 20%-30%. Listeria eziri mainly infects ruminants and brings huge losses to the livestock industry. Therefore, it is very necessary to establish a rapid and effective detection method for Listeria monocytogenes and Listeria izii for the monitoring and control of the two pathogenic Listeria. Contents of the invention [0003] The object ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/689C12Q1/686C12N15/11C12R1/01
CPCC12Q1/689C12Q1/686C12Q2537/143Y02A50/30
Inventor 焦新安殷月兰冯有为孟凡增陈思思潘志明陈祥王晶
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com