Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fluorescent quantitative PCR (polymerase chain reaction) reagent kit for detecting Listeria monocytogenes

A technique for monocytosis and Listeria monocytogenes is applied in the field of molecular biology detection kits, which can solve the problems of variant identification, limited identification ability, difficulty, etc.

Inactive Publication Date: 2012-07-18
QILU UNIV OF TECH
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For a long time, the detection method of LM is mainly the traditional national standard culture method (GB4789.30-2010). The biochemical reaction and serum reaction characterized by phenotypic characteristics are used to identify LM, but the identification ability is limited, often due to phenotypic characteristics. Variations make identification difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent quantitative PCR (polymerase chain reaction) reagent kit for detecting Listeria monocytogenes
  • Fluorescent quantitative PCR (polymerase chain reaction) reagent kit for detecting Listeria monocytogenes
  • Fluorescent quantitative PCR (polymerase chain reaction) reagent kit for detecting Listeria monocytogenes

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1: the preparation of kit of the present invention

[0021] The composition of the fluorescent quantitative PCR kit for detecting Listeria monocytogenes includes:

[0022] Upstream primer H1 5'-gattcccattatgaacgaag-3' (SEQ ID No.1),

[0023] Downstream primer H2 5'-tcagttccttacagatgag-3' (SEQ ID No.2),

[0024] Fluorescent probe P1 5'-FAM-acagccagtactagttcatcgca-TAMRA-3'(SEQ ID No.3)

[0025] Positive quantitative template: pMD18-T recombinant plasmid containing a DNA fragment with the sequence catggcaccaccagcatctataggagcactcgccgccacatcatcgaaaagaaacacgcggatg (SEQ ID No. 4).

[0026] The kit can further include a fluorescent quantitative polymerase and a reference dye.

[0027] Wherein, primers and probes were searched in Genbank for hly genes of various Listeria monocytogenes and analyzed on the basis of their conserved segments, were designed using Bacon Designer 5.0 software, and were synthesized according to conventional methods in the art.

[0028] Th...

Embodiment 2

[0030] Example 2 Detection of Listeria monocytogenes using a kit

[0031] 1. Processing of samples to be tested

[0032] Extract DNA from the sample to be tested. The DNA extraction kit actually used in the examples of this application was purchased from Takara Company.

[0033] 2. Fluorescent quantitative PCR process

[0034] The reaction system (25 μL) is: template DNA 2.0 μL, 10 μM primer 1.0 μL, 3 μM probe 1.0 μL, Premix Ex Taq TM (2×) 12.5 μL of fluorescent quantitative polymerase, 0.5 μL of ROX Reference Dye II (50×) dye, 8 μL of sterile water.

[0035] The reaction program is: 95°C pre-denaturation for 30 seconds, followed by 40 cycles, each cycle program is 95°C for 5 seconds, 60°C for 20 seconds.

[0036] In the examples of this application, the 480 fluorescent quantitative PCR instrument of Roche Company was actually used to record the results.

[0037] 3. Standard curve preparation

[0038] After the quantitative positive template was linearized, it was dilute...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention provides a fluorescent quantitative PCR (polymerase chain reaction) reagent kit for detecting Listeria monocytogenes, which comprises a pair of primers, a probe and a positive quantitative template. The sequences of the primers and the sequence of the probe are respectively SEQ ID No.1, SEQ ID No.2 and SEQ ID No.3, the positive quantitative template is pMD 18-T recombinant plasmid with the sequence of SEQ ID No.4, the reagent kit further can comprise fluorescent quantitative polymerase and reference dye, and application of the reagent kit to detecting the Listeria monocytogenes in clinical samples is also provided. Experimental results show that the fluorescent quantitative PCR reagent kit for detecting the Listeria monocytogenes is high in specificity and sensitivity, simple in composition and convenient in operation, and can be used for quickly detecting the Listeria monocytogenes.

Description

technical field [0001] The invention relates to a molecular biology detection kit for bacteria in the field of biotechnology, in particular to a fluorescent quantitative PCR kit for detecting Listeria monocytogenes and its application Background technique [0002] Listeria monocytogenes (Listeria monocytogenes, LM) is an important zoonotic pathogen, which can grow and reproduce at 4°C, and can cause meningitis, sepsis, and abortion of pregnant women in humans and animals, and the mortality rate is extremely high. High, up to 30% to 70%. It has received more and more attention in public health and food hygiene safety, and has become one of the strains for national foodborne disease detection. For a long time, the detection method of LM is mainly the traditional national standard culture method (GB4789.30-2010). The biochemical reaction and serum reaction characterized by phenotypic characteristics are used to identify LM, but the identification ability is limited, often due ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12R1/01
Inventor 朱丽萍颜世敢吕爱杰
Owner QILU UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com