Method of introducing a plurality of DNA fragments simultaneously into DNA vector
A fragment and vector technology, applied in the field of genetic engineering, can solve the problems of time-consuming, cumbersome methods, and many limiting factors.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] Example 1: Cloning the oriT-Am gene cassette and rpsL gene into pBluescript KS(-), while removing the ampicillin resistance gene part of pBluescript KS(-)
[0043] Amplification of the oriT-Am gene cassette with homology arms
[0044] Primer CT1: 5′-
[0045] AAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAA
[0046] CTGCAGGTCCCCGGGGATCGGTC-3′
[0047] The first 50 bases are part 1801 to 1850 of pBluescript KS(-), and the latter about 23 bases are the 5' end sequence of the amplified oriT-Am gene cassette at 2517-2540 in plasmid pOJ446;
[0048] Primer CT2: 5′-TCAGCCAATCGACTGGCGAGCGGCATCGCA-3′30 bases are 4255-4284 of pOJ446 to amplify the 3′ sequence of the oriT-Am gene cassette; using pOJ446 as a template, a pair of primers CT1 and CT2 were passed through PCR (polymerase chain Reaction) to amplify a 2.0 kb oriT-Am gene cassette with homology arms.
[0049] Amplification of the rpsL gene with homology arms
[0050] Primer CT3:
[0051] 5′-TGCGATGCCGCTCGCCAGTC...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 