Liver cancer related gene DLK1 and uses thereof
A liver cancer and gene technology, applied in the field of molecular biology and genetic engineering, can solve the problems of little knowledge and poor prognosis of liver cancer
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Construct and identify the RNAi plasmid of DLK1
[0023] In this example, the pSUPER plasmid was introduced to construct an RNAi plasmid capable of relatively stable transfection of cells. The plasmid contains the H1-RNA polymerase III gene promoter, the cDNA sequence oligonucleotide that can transcribe the short-chain hairpin structure RNA (shRNA) is inserted into the promoter of the pSUPER plasmid, and the vector is transfected into the cell Afterwards, shRNA with a hairpin-like structure can be stably synthesized in the cell, that is, a relatively stable effect of silencing the target gene can be achieved.
[0024] The oligonucleotide sequences used in this example are as follows:
[0025] 1. pSUPER Luc+:
[0026] Forward primer: gatccccctt acgctgagta cttcgattca agagatcgaa gtactcagcgtaagtttttg gaaa
[0027] Reverse primer: agcttttcca aaaacttacg ctgagtactt cgatctcttg aatcgaagtactcagcgtaa gggg
[0028] 2. pSUPER DLK874:
[0029] Forward primer: gatccccgg...
Embodiment 2
[0044] Example 2 Instantaneous clone formation test (proving that the clone formation ability of HCC cells is reduced after the expression of DLK1 is inhibited)
[0045] On the basis of identifying that the RNAi mediated by the pSUPER vector is effective, three kinds of endogenously expressing DLK1 cells in Example 1 were subjected to a transient clone formation test (see figure 2 , image 3 ), and HCC cell line Bel-7402 cells without endogenous DLK1 expression were used as control cells.
[0046] The pSUPER empty plasmid, pSUPER DLK874, pSUPER DLK1011 plasmid and pcDNA3.0 plasmid were co-transfected into Hep3B, HepG2, Huh-7 and Bel-7402 cells at a ratio of 10 to 1, where the pcDNA3.0 plasmid was transfected The latter cells provide G418 resistance. After transfection, an equal amount of cells from each control group were divided into 100mm cell culture dishes for culture, and were screened with MEM or DMEM complete culture medium containing appropriate concentration of G41...
Embodiment 3
[0048] Example 3 Western Blotting analysis (to prove that the growth and proliferation ability of Huh-7 cells is reduced after the expression of DLK1 is inhibited)
[0049] Taking Huh-7 cells as the target, pSUPER empty plasmid, pSUPER DLK874, pSUPER DLK1011 plasmid and pcDNA3.0 plasmid were co-transfected into Huh-7 cells at a ratio of 10 to 1, respectively, to construct Huh-7 stable DLK1 expression inhibiting cell lines, and Western Blotting Analysis was used to identify the expression of DLK1 at the protein level in four of the stable cell lines (see Figure 4 ).
[0050] Figure 4 Among them, pSUPER C5 is a stable pSUPER empty plasmid cell line; p1011 B3 and p1011 A4 are subclones formed after stably transfected with pSUPER DLK1011; p874 C2 is a subclone formed after stably transfected with pSUPER DLK874. Two cell lines Huh-7 p874 C2 and Huh-7p1011A4 with stable down-regulation of DLK1 were obtained, while the expression of DLK1 in the stable strain Huh-7 p1011 B3 was no...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap