Liver cancer related gene DLK1 and uses thereof

A liver cancer and gene technology, applied in the field of molecular biology and genetic engineering, can solve the problems of little knowledge and poor prognosis of liver cancer

Inactive Publication Date: 2008-06-18
CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
View PDF0 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Liver cancer is known as the "national disease" in my country. After half a century of exploration, although there is a certain understanding of the early diagnosis and treatment of liver cancer, the prognosis of liver cancer is still very poor, especially the understanding of its pathogenesis and treatment. Even less is known about new targets for drugs

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Liver cancer related gene DLK1 and uses thereof
  • Liver cancer related gene DLK1 and uses thereof
  • Liver cancer related gene DLK1 and uses thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construct and identify the RNAi plasmid of DLK1

[0023] In this example, the pSUPER plasmid was introduced to construct an RNAi plasmid capable of relatively stable transfection of cells. The plasmid contains the H1-RNA polymerase III gene promoter, the cDNA sequence oligonucleotide that can transcribe the short-chain hairpin structure RNA (shRNA) is inserted into the promoter of the pSUPER plasmid, and the vector is transfected into the cell Afterwards, shRNA with a hairpin-like structure can be stably synthesized in the cell, that is, a relatively stable effect of silencing the target gene can be achieved.

[0024] The oligonucleotide sequences used in this example are as follows:

[0025] 1. pSUPER Luc+:

[0026] Forward primer: gatccccctt acgctgagta cttcgattca agagatcgaa gtactcagcgtaagtttttg gaaa

[0027] Reverse primer: agcttttcca aaaacttacg ctgagtactt cgatctcttg aatcgaagtactcagcgtaa gggg

[0028] 2. pSUPER DLK874:

[0029] Forward primer: gatccccgg...

Embodiment 2

[0044] Example 2 Instantaneous clone formation test (proving that the clone formation ability of HCC cells is reduced after the expression of DLK1 is inhibited)

[0045] On the basis of identifying that the RNAi mediated by the pSUPER vector is effective, three kinds of endogenously expressing DLK1 cells in Example 1 were subjected to a transient clone formation test (see figure 2 , image 3 ), and HCC cell line Bel-7402 cells without endogenous DLK1 expression were used as control cells.

[0046] The pSUPER empty plasmid, pSUPER DLK874, pSUPER DLK1011 plasmid and pcDNA3.0 plasmid were co-transfected into Hep3B, HepG2, Huh-7 and Bel-7402 cells at a ratio of 10 to 1, where the pcDNA3.0 plasmid was transfected The latter cells provide G418 resistance. After transfection, an equal amount of cells from each control group were divided into 100mm cell culture dishes for culture, and were screened with MEM or DMEM complete culture medium containing appropriate concentration of G41...

Embodiment 3

[0048] Example 3 Western Blotting analysis (to prove that the growth and proliferation ability of Huh-7 cells is reduced after the expression of DLK1 is inhibited)

[0049] Taking Huh-7 cells as the target, pSUPER empty plasmid, pSUPER DLK874, pSUPER DLK1011 plasmid and pcDNA3.0 plasmid were co-transfected into Huh-7 cells at a ratio of 10 to 1, respectively, to construct Huh-7 stable DLK1 expression inhibiting cell lines, and Western Blotting Analysis was used to identify the expression of DLK1 at the protein level in four of the stable cell lines (see Figure 4 ).

[0050] Figure 4 Among them, pSUPER C5 is a stable pSUPER empty plasmid cell line; p1011 B3 and p1011 A4 are subclones formed after stably transfected with pSUPER DLK1011; p874 C2 is a subclone formed after stably transfected with pSUPER DLK874. Two cell lines Huh-7 p874 C2 and Huh-7p1011A4 with stable down-regulation of DLK1 were obtained, while the expression of DLK1 in the stable strain Huh-7 p1011 B3 was no...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses an application of DLK1 gene for preparing a RNA interference medicine for remedying the primary liver cancer and provides a siRNA sequence which considers the DLK1 gene as a target point. The present invention comprises the carrier of the siRNA sequence which considers the DLK1 gene as the target point and a host cell and also provides a biological chip and a kit for remedying and diagnosing the liver cancer. The DLK1 is considered as the target point for preparing the medicine for remedying the primary liver cancer, which ensures that the liver cancer is likely to be conquered.

Description

technical field [0001] The present invention relates to the fields of molecular biology and genetic engineering, specifically, the present invention relates to liver cancer-related gene DLK1, a group of siRNAs targeting its mRNA sequence, and its use in the preparation of reagents for diagnosing liver cancer and drugs for gene therapy of liver cancer application. Background technique [0002] At present, there are about 12 million patients with chronic hepatitis in my country, and about 300,000 people die of liver disease every year, 50% of which are primary liver cancer, accounting for about 45% of the death toll of liver cancer in the world. The vast majority are related to HBV and HCV infection. The incidence rate of liver cancer ranks 2-3 in my country, mainly in young and middle-aged men, and the incidence rate in East China is significantly higher than that in other regions. In recent years, it has continued to rise. In Shanghai, the incidence of liver cancer ranks t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/12A61K48/00A61K31/7088A61P35/00C12Q1/68
Inventor 韩泽广黄健张新
Owner CHINESE NAT HUMAN GENOME CENT AT SHANGHAI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap