HBV core area resisting siRNA expression template and application
A technology for expressing templates and core regions, applied in DNA/RNA fragments, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve problems such as low efficiency and potential safety hazards, achieve obvious effects, improve efficiency, and inhibit replication and the effect of expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] 1. Construction of gene-targeted siRNA expression plasmids
[0024] 1.1 Preparation of expression plasmid
[0025] Purchase the pRNAT-U6.1 / Neo plasmid from GenScript, which is an siRNA expression plasmid designed for transfection of mammalian cells. The plasmid carries a neomycin resistance gene as a selection marker to establish a stable cell line, located at the CMV promoter The GFP (green fluorescent protein) gene under the U6 promoter can be used to track the transfection efficiency of the plasmid, and multiple cloning sites are designed under the U6 promoter. In the present invention, we use its BamHI and HindIII restriction sites for cloning.
[0026] 1.2 Design of siRNA template sequence
[0027] GeneScript company provides online siRNA template sequence design software, using this software to design siRNA template sequence, we find a target sequence for the core region of HBV:
[0028] 5'TCCTACTGTTCAAGCCTCCAA 3'
[0029] According to it, a pair of siRNA templ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com