Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

HBV core area resisting siRNA expression template and application

A technology for expressing templates and core regions, applied in DNA/RNA fragments, recombinant DNA technology, medical preparations containing active ingredients, etc., can solve problems such as low efficiency and potential safety hazards, achieve obvious effects, improve efficiency, and solve safety problems The effect of sexual problems

Inactive Publication Date: 2010-11-03
苏先狮
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Gene delivery has always been a difficult problem in gene therapy and transgenic research. At present, adenovirus vectors and liposome-DNA complexes are commonly used for gene delivery, but these two methods have problems such as safety hazards and low efficiency. Nano The penetration of technology in the biological field has formed nano-biotechnology, and the research on nano-drug carriers is the focus and hotspot of nano-biotechnology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • HBV core area resisting siRNA expression template and application
  • HBV core area resisting siRNA expression template and application
  • HBV core area resisting siRNA expression template and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] 1. Construction of gene-targeted siRNA expression plasmids

[0024] 1.1 Preparation of expression plasmid

[0025] Purchase the pRNAT-U6.1 / Neo plasmid from GenScript, which is an siRNA expression plasmid designed for transfection of mammalian cells. The plasmid carries a neomycin resistance gene as a selection marker to establish a stable cell line, located at the CMV promoter The GFP (green fluorescent protein) gene under the U6 promoter can be used to track the transfection efficiency of the plasmid, and multiple cloning sites are designed under the U6 promoter. In the present invention, we use its BamHI and HindIII restriction sites for cloning.

[0026] 1.2 Design of siRNA template sequence

[0027] GeneScript company provides online siRNA template sequence design software, using this software to design siRNA template sequence, we find a target sequence for the core region of HBV:

[0028] 5'TCCTACTGTTCAAGCCTCCAA 3'

[0029] Based on it, a pair of siRNA template ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention closes HBV core region through adopting siRNA technique to combine with a nanometer technique and inhibits the expression of HBcAg, and finally inhibits the expression and copy of HBV. The invention has wide target and obvious effect, which improves gene inducing efficiency through adopting the nanometer technique.

Description

technical field [0001] The invention relates to gene medicine, in particular to an siRNA expression template against HBV core region. Background technique [0002] Persistent infection with hepatitis B virus (HBV) is one of the current serious global health problems and the most common cause of chronic liver disease. At present, there are about 350 million chronic hepatitis B virus-infected patients in the world, 75% of which are distributed in the Asia-Pacific region. Chronic hepatitis B has a poor prognosis and can develop into cirrhosis and liver cancer. The current antiviral therapy to control HBV persistent infection mainly uses nucleoside analogs and recombinant interferon antiviral drugs. But so far, the curative effect of antiviral treatment of chronic hepatitis B is not satisfactory, and the sustained response rate of high-dose recombinant interferon is only about 30%. Although nucleoside analogues such as lamivudine have strong antiviral activity, However, the r...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/11C12N15/63A61K31/713A61P31/20C12N15/113
Inventor 苏先狮
Owner 苏先狮
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com