Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for identifying Y excellent series hybrid rice germ plasm

A technology of hybrid rice and identification method, which is applied in the field of identification of Yyou series hybrid rice germplasm, and achieves the effects of short detection time, accurate identification and large quantity

Inactive Publication Date: 2009-04-15
HUNAN HYBRID RICE RES CENT
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the two-line hybrid rice seed production is regulated by ecological factors such as light and temperature, and there are always some risks in the purity of the seed production. Large-scale production requires that the hybrid rice seeds obtained after seed production can be quickly and accurately tested. purity testing; at the same time, the protection of variety rights for new Y series varieties also requires molecular markers to provide new technical support

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] (1), screen out the primers that can be used for Y excellent series hybrid rice germplasm identification in the following way:

[0044] ①. In the Gramene database, 12 rice chromosomes were found, and 5 SSR primers were randomly selected from each chromosome.

[0045] ②. Find the RM164 of chromosome 5 from the SSR primer obtained in step ①. The DNA sequence of the RM164 is:

[0046]forward sequence TCTTGCCCGTCACTGCAGATATCC,

[0047] Reverse sequence GCAGCCCTAATGCTACAATTCTTC.

[0048] (2), using the primers obtained in the above step (1) to perform PCR amplification on the rice sample 07A1 and the rice sample 07A2 submitted for identification:

[0049] ①. Use the PCR system to carry out PCR amplification. The components of the PCR system used are:

[0050] 1 μl of DNA template with a concentration of 25ng / μl

[0051] 2 μl of 10×PCR buffer with a pH value of 8.3

[0052] 1 μl of dNTPs at a concentration of 2.5 mM

[0053] 0.2 μl of Taq enzyme at a concentration of 5 ...

Embodiment 2

[0069] (1), screen out the primers that can be used for Y excellent series hybrid rice germplasm identification in the following way:

[0070] ①. In the Gramene database, 12 rice chromosomes were found, and 10 SSR primers were randomly selected from each chromosome.

[0071] 2. From the SSR primers obtained in step 1., find RM164, RM18 of the 7th chromosome, and RM258 of the 10th chromosome of the primers that can be used to identify the Y excellent series hybrid rice germplasm, wherein,

[0072] The DNA sequence of RM164 of chromosome 5 is:

[0073] forward sequence TCTTGCCCGTCACTGCAGATATCC,

[0074] reverse sequence GCAGCCCTAATGCTACAATTCTTC,

[0075] The DNA sequence of RM18 on chromosome 7 is:

[0076] forward sequence TTCCCTCTCATGAGCTCCAT,

[0077] reverse sequence GAGTGCCTGGCGCTGTAC,

[0078] The DNA sequence of RM258 on chromosome 10 is:

[0079] Forward sequence TGCTGTATGTAGCTCGCACC,

[0080] Reverse sequence TGGCCTTTAAAGCTGTCGC.

[0081] (2), using the primers ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for identifying the germ plasm of Y-superior serial hybrid rice, comprising the following steps: (1) a primer which can be used for identifying the germ plasm of Y-superior serial hybrid rice is selected; (2) the PCR augmentation on rice samples to be identified is carried out by the obtained primer; (3) the electrophoresis detection for a DNA special marker is carried out; (4) the molecule id card number which is corresponding to the rice samples to be identified is manufactured according to the obtained DNA special marker scattergram, when the first digit of the number is '1', only one digit '1' can appear from the second digit to the fifth digit, and the rice samples to be indentified is Y-superior serial hybrid rice, otherwise the identifying conclusion is contrary. By making use of the method, the varieties and the parent-strain germ plasm of the Y-superior serial hybrid rice can be indentified. The invention has the advantages of short detecting time, large quantity, high efficiency and accurate seed purity identification, thereby the risk of the large-area production of the hybrid rice can be greatly reduced.

Description

technical field [0001] The invention relates to an identification method for Yyou series hybrid rice germplasm, belonging to the technical field of plant variety identification. Background technique [0002] Effectively ensuring the purity of hybrid rice seeds is an important link in the popularization and application of hybrid rice, and the establishment of a rapid, accurate and efficient technical system for identifying hybrid rice germplasm is the key to solving this problem. At present, field planting identification is considered to be the most accurate and reliable method in the identification of hybrid rice seed purity. However, the identification period of field planting is long and it is easily affected by the external environment, which has great limitations. In response to this problem, methods such as seed morphology identification, esterase isoenzyme identification, and DNA (abbreviation of English deoxyribonucleic acid, Chinese translation deoxyribonucleic acid...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N27/447C12Q1/68
Inventor 邓启云武文王斌庄文熊跃东
Owner HUNAN HYBRID RICE RES CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More