Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting product of loop-mediated isothermal amplification

A loop-mediated isothermal, loop-detecting technology, applied in microorganism-based methods, biochemical equipment and methods, and microbial assay/inspection, etc., can solve problems that limit the practical application of LAMP technology and cannot rule out false positives.

Inactive Publication Date: 2010-03-03
天津朝海科技有限公司
View PDF0 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using conventional detection methods for DNA products prepared by LAMP amplification, such as electrophoresis, fluorescent dyes, etc., cannot eliminate the false positive problem caused by LAMP amplification, and requires special instruments, which limits the application of LAMP technology. practical application

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting product of loop-mediated isothermal amplification
  • Method for detecting product of loop-mediated isothermal amplification
  • Method for detecting product of loop-mediated isothermal amplification

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] HIV testing

[0020] LAMP amplification technology is used to amplify the specific messenger RNA (mRNA) infected by HIV virus from the sample, and the amplified product is detected by the nano-gold particle probe, so as to determine whether the source of the sample (human, animal) has been infected by HIV . Mainly used for rapid diagnosis of HIV infection.

[0021] Experimental materials and methods

[0022] 1. Design LAMP amplification primers for HIV virus, and design sulfhydryl-modified DNA probes for gold nanoparticle probe detection.

[0023] targeting sequence

[0024] AAGGCTTTTAGCCCAGAAGTAATACCCATGTTTACAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGTTAAATACAGTAGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGATACCATCAATGAAGAGGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCAGTGGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACTCTTCAGGAGCAAATAGGATGGATGACAAGTAATCCACCTATCCCAGTAGGAGA

[0025] Thiol-modified DNA probe sequence

[0026] 5'-AGTGGCACCAGGCCAGAAAAAAAAA-SH-3'

[0027] Pri...

Embodiment 2

[0050] Influenza Virus Detection

[0051] LAMP amplification technology is used to amplify the DNA of influenza virus (H1N1, H3N2 and H5N1) M1 protein from the sample, and the gold nanoparticle probe detects the amplified DNA product to determine whether the sample contains influenza virus. It is mainly used for rapid diagnosis of influenza virus.

[0052] Experimental materials and methods

[0053] 1. Design LAMP amplification primers for influenza virus M1 protein, and design sulfhydryl-modified DNA probes for gold nanoparticle probe detection.

[0054] targeting sequence

[0055] ATATTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCGTCCCGTCAGGCCCCCTCAAAGCCGAGATCGCACAGAGACTTGAAGATGTCTTTGCTGGAAAGAACACCGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCGATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTGTTCACGCTCACCGTGCCCACTGAGCGAGGACTGCATCGTACACTCTTTGTCCAAAATGCCCTTAATGGGAATGGGGATCCAAATAATATGGACAGAGCAGTTAAACTGTATAGAAAGCTTAAGAGGGAGATAACATTCCATGGGGCCAAAGAAATA

[0056] Thiol-modified DNA probe sequence ...

Embodiment 3

[0081] E. coli detection

[0082] LAMP amplification technology is used to amplify the specific DNA of Escherichia coli from the sample, and the gold nanoparticle probe detects the amplified product, so as to determine whether the sample contains Escherichia coli. It is mainly used for rapid detection of Escherichia coli.

[0083] Experimental materials and methods

[0084] 1. Design primers for LAMP amplification for Escherichia coli, and design sulfhydryl-modified DNA probes for gold nanoparticle probe detection.

[0085] targeting sequence

[0086] GCCATCTCCTGATGACGCATAGTCAGCCCATCATGAATGTTGCT*GTCGATGACAGGTTGTTACAAAGGGAGAAGGGCATGGCGAGCGTACAGCTGCAAAATGTAACGAAAGCCTGGGGCGAGGTCGTGGTATCGAAAGATATCAATCTCGATATCCATGAAGGTG*AATTCGTGGTGTTTGTCGGACCGTCTGGCTGCGGTAAAT

[0087] Thiol-modified DNA probe sequence

[0088] 5'-TGTAACGAAAGCCTGGAAAAAAAAA-SH-3'

[0089] Primer sequence

[0090] F3 primers for E. coli

[0091] 5'-GCCATCTCCTGATGACGG-3'

[0092] B3 Primer for E. coli

[0093]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting a product of loop-mediated isothermal amplification (LAMP) by gold nano-particles. The method comprises the following steps: firstly, preparing gold nano-particles labeled with molecular probes; amplifying DNA or RNA to be detected by the loop-mediated isothermal amplification; and molecularly hybridizing the DNA molecules of the product of looped-mediated isothermal amplification by the gold nano-particles labeled by the molecular probes so as to promote the gold nano-particles to be close and cause color changes. According to changes of color signals, the method determines whether a sample to be detected contains the DNA or the RNA to be detected or not. The method has the advantages of high sensitivity, good specificity, simple and convenient operation, quickness without professional equipment and the like.

Description

technical field [0001] The invention relates to a method for detecting DNA produced by an isothermal nucleic acid amplification technology using a gold nanoparticle detection loop, and belongs to the technical field of biological detection. Background technique [0002] The high sensitivity, high specificity, simple and rapid detection of genes (DNA) and their transcription products (RNA) is very useful for early diagnosis and treatment of diseases, as well as in the fields of health and epidemic prevention, environmental monitoring, inspection and quarantine, etc. Significance. In the past, more accurate and sensitive detection methods in this regard include fluorescent labeling, radioactive labeling and other methods. These methods require complex operations and special equipment, and their application range is very narrow. In 1993, Dr.Kary B.Mullis of PE Company invented the polymerase chain reaction (Polymerase Chain Reaction), referred to as PCR. Subsequently, PCR tec...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/70C12R1/93C12R1/19C12R1/44C12R1/01
Inventor 高利增孙国明
Owner 天津朝海科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com