Method for detecting product of loop-mediated isothermal amplification
A loop-mediated isothermal, loop-detecting technology, applied in microorganism-based methods, biochemical equipment and methods, and microbial assay/inspection, etc., can solve problems that limit the practical application of LAMP technology and cannot rule out false positives.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] HIV testing
[0020] LAMP amplification technology is used to amplify the specific messenger RNA (mRNA) infected by HIV virus from the sample, and the amplified product is detected by the nano-gold particle probe, so as to determine whether the source of the sample (human, animal) has been infected by HIV . Mainly used for rapid diagnosis of HIV infection.
[0021] Experimental materials and methods
[0022] 1. Design LAMP amplification primers for HIV virus, and design sulfhydryl-modified DNA probes for gold nanoparticle probe detection.
[0023] targeting sequence
[0024] AAGGCTTTTAGCCCAGAAGTAATACCCATGTTTACAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGTTAAATACAGTAGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGATACCATCAATGAAGAGGCTGCAGAATGGGATAGATTGCATCCAGTGCATGCAGGGCCAGTGGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACTCTTCAGGAGCAAATAGGATGGATGACAAGTAATCCACCTATCCCAGTAGGAGA
[0025] Thiol-modified DNA probe sequence
[0026] 5'-AGTGGCACCAGGCCAGAAAAAAAAA-SH-3'
[0027] Pri...
Embodiment 2
[0050] Influenza Virus Detection
[0051] LAMP amplification technology is used to amplify the DNA of influenza virus (H1N1, H3N2 and H5N1) M1 protein from the sample, and the gold nanoparticle probe detects the amplified DNA product to determine whether the sample contains influenza virus. It is mainly used for rapid diagnosis of influenza virus.
[0052] Experimental materials and methods
[0053] 1. Design LAMP amplification primers for influenza virus M1 protein, and design sulfhydryl-modified DNA probes for gold nanoparticle probe detection.
[0054] targeting sequence
[0055] ATATTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCGTCCCGTCAGGCCCCCTCAAAGCCGAGATCGCACAGAGACTTGAAGATGTCTTTGCTGGAAAGAACACCGATCTTGAGGCTCTCATGGAATGGCTAAAGACAAGACCGATCCTGTCACCTCTGACTAAGGGGATTTTAGGATTTGTGTTCACGCTCACCGTGCCCACTGAGCGAGGACTGCATCGTACACTCTTTGTCCAAAATGCCCTTAATGGGAATGGGGATCCAAATAATATGGACAGAGCAGTTAAACTGTATAGAAAGCTTAAGAGGGAGATAACATTCCATGGGGCCAAAGAAATA
[0056] Thiol-modified DNA probe sequence ...
Embodiment 3
[0081] E. coli detection
[0082] LAMP amplification technology is used to amplify the specific DNA of Escherichia coli from the sample, and the gold nanoparticle probe detects the amplified product, so as to determine whether the sample contains Escherichia coli. It is mainly used for rapid detection of Escherichia coli.
[0083] Experimental materials and methods
[0084] 1. Design primers for LAMP amplification for Escherichia coli, and design sulfhydryl-modified DNA probes for gold nanoparticle probe detection.
[0085] targeting sequence
[0086] GCCATCTCCTGATGACGCATAGTCAGCCCATCATGAATGTTGCT*GTCGATGACAGGTTGTTACAAAGGGAGAAGGGCATGGCGAGCGTACAGCTGCAAAATGTAACGAAAGCCTGGGGCGAGGTCGTGGTATCGAAAGATATCAATCTCGATATCCATGAAGGTG*AATTCGTGGTGTTTGTCGGACCGTCTGGCTGCGGTAAAT
[0087] Thiol-modified DNA probe sequence
[0088] 5'-TGTAACGAAAGCCTGGAAAAAAAAA-SH-3'
[0089] Primer sequence
[0090] F3 primers for E. coli
[0091] 5'-GCCATCTCCTGATGACGG-3'
[0092] B3 Primer for E. coli
[0093]...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap