PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA
A detection kit and detection primer technology, applied in DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of loss of morphological characteristics, difficulty in identification of tiger and leopard products, etc., and achieve the effect of low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Example 1 Establishment of PCR detection kit and detection method for tiger and leopard DNA
[0029] 1. Design of PCR detection primers for tiger and leopard DNA
[0030] According to the differences in mtDNA cytochrome b gene sequences between tigers and leopards and other cats and mammals, and the principle of primer design, the primer sequences designed for detection are as follows:
[0031] Forward primer (SEQ ID NO. 1): 5'GAATATACTATGGCTCCTACAC 3',
[0032] Reverse primer (SEQ ID NO. 2): 5'GGTTGGCGGGGATGTAGTTA 3'.
[0033] 2. Construction of PCR detection kit for tiger and leopard DNA
[0034] On the basis of obtaining the above-mentioned specific primer pairs, a kit for PCR detection of tiger and leopard DNA is designed. The detection solution contains 10×PCR buffer, 10μmol / L forward primer, 10μmol / L reverse primer, 10mmol / L dNTP, 5U / μL Taq DNA polymerase; wherein the forward primer sequence is SEQ ID NO. 1, and the reverse primer sequence is SEQ ID NO.2.
[0035] 3. Establi...
Embodiment 2
[0053] Example 2 Specific Experiment
[0054] The detection kit and detection method containing specific primers of Example 1 were used to detect tiger-derived and leopard-derived DNA samples. Simultaneously detect the DNA samples of lions, bears, cows and other animals to evaluate the specificity of the method.
[0055] Test results: The PCR electrophoresis patterns of tiger and leopard species-specific test results are as follows figure 1 As shown, figure 1 Middle: 1.H 2 O, 2. Siberian tiger blood, 3. Siberian tiger meat, 4. Indochinese tiger blood, 5. Bengal tiger blood, 6. Leopard blood, 7. Snow leopard blood, 8. Asian lion blood, 9. East African lion blood, 10 Black bear blood, 11. Beef bone meal, 12. Sheep bone meal, 13. Pork bone meal, 14. Donkey bone meal, 15. Rabbit bone meal, 16. Deer bone meal, 17. Horse bone meal, 18. Dog bone meal. The test results showed that the blood and muscle tissue DNA samples of the tiger and leopard species, the blood and muscle tissue DNA sam...
Embodiment 3
[0056] Example 3 Sensitivity experiment
[0057] For the extracted Siberian tiger blood DNA and Leopard blood DNA template, the concentration and purity were detected by an ultraviolet spectrophotometer. Adjust the initial concentration to 100ng / μL with TE solution, and perform a 10-fold gradient dilution. The concentrations are: 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL and 1pg / μL. Different concentrations of templates are subjected to PCR reactions to determine the sensitivity of detection.
[0058] The test was carried out according to the PCR reaction conditions, and the results of Siberian tiger blood DNA test were as follows figure 2 As shown, figure 2 Medium: 1.100ng / μL tiger blood DNA, 2.10ng / μL tiger blood DNA, 3.1ng / μL tiger blood DNA, 4.100pg / μL tiger blood DNA, 5.10pg / μL tiger blood DNA, 6.1pg / μL tiger blood DNA, 7.0.1pg / μL tiger blood DNA. The test results show that specific PCR amplified bands can be detected in 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL Siberian tiger...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 