Unlock instant, AI-driven research and patent intelligence for your innovation.

PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA

A technology for detection kits and detection primers, which can be applied in the fields of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of loss of morphological characteristics, difficulty in identification of tiger and leopard products, etc., and achieve the effect of low cost

Inactive Publication Date: 2012-06-20
徐君怡 +2
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In the process of wild animal evidence collection, in some cases the products lost their identifiable morphological characteristics after processing, making the identification of tiger and leopard products very difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA
  • PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA
  • PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] The establishment of the PCR detection kit and detection method of embodiment 1 tiger, leopard DNA

[0030] 1. Design of primers for PCR detection of tiger and leopard DNA

[0031] According to the differences in the mtDNA cytochrome b gene sequences of tigers, leopards and other cats and mammals, and the principles of primer design, the primer sequences designed for detection are as follows:

[0032] Forward primer (SEQ ID NO.1): 5'GAATATACTATGGCTCCTACAC 3',

[0033] Reverse primer (SEQ ID NO. 2): 5'GGTTGGCGGGGATGTAGTTA 3'.

[0034] 2. Construction of PCR detection kits for tiger and leopard DNA

[0035] On the basis of obtaining the above-mentioned specific primer pair, a kit for PCR detection of tiger and leopard DNA was designed, and the detection solution contained 10×PCR buffer, 10 μmol / L forward primer, 10 μmol / L reverse primer, 10mmol / L dNTP, 5U / μL Taq DNA polymerase; wherein, the sequence of the forward primer is SEQ ID NO.1, and the sequence of the reverse ...

Embodiment 2

[0054] Embodiment 2 specificity experiment

[0055] The detection kit and detection method containing specific primers in Example 1 were used to detect tiger-derived and leopard-derived DNA samples. Simultaneously detect DNA samples from other animals such as lions, bears, and cattle to evaluate the specificity of the method.

[0056] Test results: The PCR electrophoresis patterns of tiger and leopard species-specific test results are as follows: figure 1 as shown, figure 1 Middle: 1.H 2 O, 2. Amur tiger blood, 3. Amur tiger meat, 4. Indochinese tiger blood, 5. Bengal tiger blood, 6. Leopard blood, 7. Snow leopard blood, 8. Asian lion blood, 9. East African lion blood, 10 .Black bear blood, 11. Bovine bone meal, 12. Sheep bone meal, 13. Pig bone meal, 14. Donkey bone meal, 15. Rabbit bone meal, 16. Deer bone meal, 17. Horse bone meal, 18. Dog bone meal. The test results showed that DNA samples of blood and muscle tissue of Amur tiger subspecies in tiger and leopard species...

Embodiment 3

[0057] Embodiment 3 Sensitivity experiment

[0058] For the extracted Amur tiger blood DNA and leopard blood DNA template, the concentration and purity were detected by ultraviolet spectrophotometer. Adjust the initial concentration to 100ng / μL with TE solution, and carry out 10-fold serial dilution, the concentrations are: 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL and 1pg / μL. Different concentrations of templates were reacted by PCR to determine the detection sensitivity.

[0059] The test was carried out according to the PCR reaction conditions, and the results of the Siberian tiger blood DNA test were as follows: figure 2 as shown, figure 2 Medium: 1.100ng / μL Tiger Blood DNA, 2.10ng / μL Tiger Blood DNA, 3.1ng / μL Tiger Blood DNA, 4.100pg / μL Tiger Blood DNA, 5.10pg / μL Tiger Blood DNA, 6.1pg / μL Tiger Blood DNA, 7. 0.1pg / μL tiger blood DNA. The test results showed that specific PCR amplification bands could be detected in 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL Siberian tige...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a PCR detection primer, a kit and a detection method for tiger-derived and leopard-derived DNA, and establishes the detection primer, the kit and the detection method of ordinary PCR detection to the tiger-derived and leopard-derived DNA. The sequence of the primer is SEQ ID NO.1 and SEQ ID NO.2; and based on the primer sequence, the invention discloses the ordinary PCR detection kit and the corresponding detection method for the tiger-derived and leopard-derived DNA comprising the primer. The primer of the invention has strong specificity, and the detection kit and the method are simple and convenient, and has accurate result and very high specificity and sensitivity.

Description

technical field [0001] The invention relates to a gene detection method for tigers and leopards. Especially the PCR detection method of the tiger and leopard gene and the specific primers and related kits involved therein. Background technique [0002] Both tigers and leopards are animals belonging to the genus Panthera in the cat family. The tiger is the largest cat in the world. There are 5 tiger subspecies, including the Siberian tiger (Panthera tigris altaica), the Sumatran tiger (P.t.sumatrae), the South China tiger (P.t.amoyensis), and the Indochinese tiger (P.t.corbetti). ) and the Bengal tiger (P.t.tigris). At present, the number of wild tigers in China is very rare. [0003] Leopards are the smallest of the four big cats in the Panthera genus (the remaining three are lions, tigers, and jaguars). Leopards have bright colors, many spots and golden fur, so they are also called leopards or leopards. [0004] For the sustainable development of wildlife trade, countr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 徐君怡曹际娟
Owner 徐君怡