PCR detection primer, kit and detection method for tiger-derived and leopard-derived DNA
A technology for detection kits and detection primers, which can be applied in the fields of DNA/RNA fragments, recombinant DNA technology, biochemical equipment and methods, etc., can solve the problems of loss of morphological characteristics, difficulty in identification of tiger and leopard products, etc., and achieve the effect of low cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] The establishment of the PCR detection kit and detection method of embodiment 1 tiger, leopard DNA
[0030] 1. Design of primers for PCR detection of tiger and leopard DNA
[0031] According to the differences in the mtDNA cytochrome b gene sequences of tigers, leopards and other cats and mammals, and the principles of primer design, the primer sequences designed for detection are as follows:
[0032] Forward primer (SEQ ID NO.1): 5'GAATATACTATGGCTCCTACAC 3',
[0033] Reverse primer (SEQ ID NO. 2): 5'GGTTGGCGGGGATGTAGTTA 3'.
[0034] 2. Construction of PCR detection kits for tiger and leopard DNA
[0035] On the basis of obtaining the above-mentioned specific primer pair, a kit for PCR detection of tiger and leopard DNA was designed, and the detection solution contained 10×PCR buffer, 10 μmol / L forward primer, 10 μmol / L reverse primer, 10mmol / L dNTP, 5U / μL Taq DNA polymerase; wherein, the sequence of the forward primer is SEQ ID NO.1, and the sequence of the reverse ...
Embodiment 2
[0054] Embodiment 2 specificity experiment
[0055] The detection kit and detection method containing specific primers in Example 1 were used to detect tiger-derived and leopard-derived DNA samples. Simultaneously detect DNA samples from other animals such as lions, bears, and cattle to evaluate the specificity of the method.
[0056] Test results: The PCR electrophoresis patterns of tiger and leopard species-specific test results are as follows: figure 1 as shown, figure 1 Middle: 1.H 2 O, 2. Amur tiger blood, 3. Amur tiger meat, 4. Indochinese tiger blood, 5. Bengal tiger blood, 6. Leopard blood, 7. Snow leopard blood, 8. Asian lion blood, 9. East African lion blood, 10 .Black bear blood, 11. Bovine bone meal, 12. Sheep bone meal, 13. Pig bone meal, 14. Donkey bone meal, 15. Rabbit bone meal, 16. Deer bone meal, 17. Horse bone meal, 18. Dog bone meal. The test results showed that DNA samples of blood and muscle tissue of Amur tiger subspecies in tiger and leopard species...
Embodiment 3
[0057] Embodiment 3 Sensitivity experiment
[0058] For the extracted Amur tiger blood DNA and leopard blood DNA template, the concentration and purity were detected by ultraviolet spectrophotometer. Adjust the initial concentration to 100ng / μL with TE solution, and carry out 10-fold serial dilution, the concentrations are: 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL and 1pg / μL. Different concentrations of templates were reacted by PCR to determine the detection sensitivity.
[0059] The test was carried out according to the PCR reaction conditions, and the results of the Siberian tiger blood DNA test were as follows: figure 2 as shown, figure 2 Medium: 1.100ng / μL Tiger Blood DNA, 2.10ng / μL Tiger Blood DNA, 3.1ng / μL Tiger Blood DNA, 4.100pg / μL Tiger Blood DNA, 5.10pg / μL Tiger Blood DNA, 6.1pg / μL Tiger Blood DNA, 7. 0.1pg / μL tiger blood DNA. The test results showed that specific PCR amplification bands could be detected in 100ng / μL, 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL Siberian tige...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 