Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR

A western equine encephalitis, real-time quantitative technology, used in fluorescence/phosphorescence, microbial determination/inspection, biochemical equipment and methods, etc., can solve the problems of time-consuming experiments and inability to quantify results.

Inactive Publication Date: 2012-07-04
MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In addition, laboratory research applications include ordinary multiplex RT-PCR and real-time quantitative RT-PCR, etc. The ordinary RT-PCR method requires gel electrophoresis, which is time-consuming and the results cannot be quantified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR
  • Kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR
  • Kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1, real-time fluorescent quantitative RT-PCR detects the kit of eastern equine encephalitis virus and western equine encephalitis virus and its application

[0053] 1. Design of primers and probes

[0054] Use SDS2.0 software to design. Primers and probes for real-time quantitative detection of Western Equine Encephalitis Virus (WEEV) were selected from the region of virus structural protein E3, and primers and probes for real-time quantitative detection of Eastern Equine Encephalitis Virus (EEEV) were selected from the region of viral non-structural protein NSP3 by sequence According to comparative analysis, the sequence homology with other viruses is less than 50%. The detection primers and probe sequences of WEEV and EEEV are listed in Table 1.

[0055] Table 1 Detection primers and probe sequences of WEEV and EEEV

[0056]

[0057] 2. Establishment and optimization of the reaction system

[0058] 1. Sample preparation

[0059] Western equine encepha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR. The kit provided by the invention comprises a primer pair as shown in the following (1) and (2): (1) EEEV forward primer: TGTGCGTACCTCCTCATCGTT, EEEV reverse primer: GACTGGCGTGAATCTCTGCT; (2) WEEV forward primer: AGGGATACCCCCGAAGGTT, WEEV reverse primer: GTGAATAGCACACGGGTGGTT. The kit can be applied to detecting EEEV and WEEV and has good sensitivity and specificity; in addition, the lowest EEEV virus titer that the kit can detect is 0.2TCID50 / ml and the WEEV virus titer that the kit can detect is 1TCID50 / ml.

Description

technical field [0001] The invention relates to a kit for detecting eastern equine encephalitis virus and western equine encephalitis virus by real-time fluorescent quantitative RT-PCR in the field of biotechnology. Background technique [0002] Eastern equine encephalitis virus (EEEV) and western equine encephalitis virus (WEEV) are two antigenically similar viruses in the Togaviridae family Alphavirus, mainly prevalent in the Americas. Both are transmitted by mosquitoes, can infect horses, birds and humans, and can cause severe symptoms of encephalitis. The fatality rate of EEEV infection can reach 36%, which is one of the most lethal encephalitis viruses. WEEV is less toxic to adults, but infection in children can produce severe encephalitis with a mortality rate of approximately 10%. But all have serious neurological sequelae. Although there are no reports of eastern equine encephalitis virus and western equine encephalitis virus infection in China at present, once th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11G01N21/64
Inventor 康晓平杨银辉李裕昌刘洪林方蔡绪禹户义李靖常国辉祝庆余
Owner MICROBE EPIDEMIC DISEASE INST OF PLA MILITARY MEDICAL ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com