37 results about "Equine encephalosis virus" patented technology

The present invention discloses a chimeric alphavirus comprising a Sindbis virus cDNA fragment, an Eastern equine encephalitis virus cDNA fragment, a Western equine encephalitis virus cDNA fragment or a combination thereof. The present also discloses the use of this chimeric alphavirus as vaccines and in serological and diagnostic assays.

The invention relates to the technical field of biological medicine, in particular to nucleic acid for encoding SARSCoV2 virus spike protein and application of the nucleic acid. Through codon optimization, the invention provides the Spike high-expression novel coronavirus mRNA vaccine based on the TC83Venezuelan Equine Encephalosis Virus (VEEV) in the alpha virus family, and the vaccine can detecta spike antibody after 14 days of inoculation in an animal experiment.

The present invention provides a Venezuelan equine encephalitis virus replicon RNA useful in the development of stable lines of mammalian, avian and insect cells in which these replicons will persistently replicate. Venezuelan equine encephalitis (VEE) virus replicons contain a number of unique adaptive mutations that make the replicons noncytopathic. The replicons remain resistant to IFN-α/β. Replicon replication leads to high-level production of heterologous proteins, which are encoded by the replicons' genome and are under the control of a viral subgenomic promoter. Also provided are methods of screening for inhibitory compounds of Venezuelan equine encephalitis virus replication and eastern equine encephalitis virus replication.

The present invention discloses an attenuated recombinant alphavirus that is incapable of replicating in mosquito cells and of transmission by mosquito vectors. These attenuated alphavirus may include but is not limited to Western Equine Encephalitis virus, Eastern equine encephalitis virus, Venezuelan equine encephalitis virus or Chikungunya virus. The present invention also discloses the method of generating such alphaviruses and their use as immunogenic compositions.

Humanized anti-VEEV antibodies can be used to prevent and/or neutralize viral infection.

The invention discloses a kit for detecting eastern equine encephalitis virus and west equine encephalitis virus by real-time fluorescence quantitative RT-PCR. The kit provided by the invention comprises a primer pair as shown in the following (1) and (2): (1) EEEV forward primer: TGTGCGTACCTCCTCATCGTT, EEEV reverse primer: GACTGGCGTGAATCTCTGCT; (2) WEEV forward primer: AGGGATACCCCCGAAGGTT, WEEV reverse primer: GTGAATAGCACACGGGTGGTT. The kit can be applied to detecting EEEV and WEEV and has good sensitivity and specificity; in addition, the lowest EEEV virus titer that the kit can detect is 0.2TCID50/ml and the WEEV virus titer that the kit can detect is 1TCID50/ml.

Construction of a recombinant gene fusion encoding a human IgG1 heavy chain constant region and a single-chain variable fragment antibody of 1A4A1 monoclonal antibody is disclosed. The recombinant antibody of the present invention confers human immune effector functions on murine antibodies. After expression in bacteria as inclusion bodies, the recombinant antibody was purified and refolded in vitro. The recombinant soluble antibody retains high antigen-binding affinity to VEE and possesses some human IgG crystallizable fragment domain functions. On non-reducing gel electrophoresis analysis, disulfide bond formation was found in the hinge region of the recombinant antibody. The present invention shows that the recombinant antibody is in a native, functionally active form and it provides the basis to characterize the recombinant antibody for efficacy in vivo.

The present invention discloses a chimeric alphavirus comprising a Sindbis virus cDNA fragment and an Eastern equine encephalitis virus cDNA fragment. The present also discloses the use of this chimeric alphavirus as vaccines and in serological and diagnostic assays.

A genetically biotinylated single chain fragment variable (scFv) antibody against Venezuelan equine encephalitis virus (VEE) being applied in a system consisting of an immunofiltration-enzyme assay (IFA) with a light addressable potentiometric sensor (LAPS) for the rapid identification of VEE is disclosed. The IFA entails formation of an immunocomplex sandwich consisting of VEE, biotinylated antibody, fluoresceinated antibody and streptavidin, capturing the sandwich by filtration on biotinylated membrane, and detecting the sandwich by anti-fluorescein urease conjugate. The concentration ratio of biotinylated to fluoresceinated antibodies is investigated and optimized. The IFA/LAPS assay sensitivity was approximately equal to that of a conventional enzyme-linked immunosorbant assay utilizing polystyrene plates and a chromogenic substrate, however, less time and effort were required for performance of the IFA/LAPS assay.

The invention discloses N4-hydroxycytidine monohydrochloride, a crystal form C and a preparation method thereof. The N4-hydroxycytidine monohydrochloride has the effect of preventing and treating infection of various viruses including new coronal pneumonia and is shown in a formula I. N-hydroxycytidine and hydrochloric acid are subjected to a salt forming reaction, a crystallization solvent is added after a solvent is removed, and the N4-hydroxycytidine monohydrochloride is prepared through dissolving, crystallizing, filtering and drying. The N4-hydroxycytidine monohydrochloride and the crystal form C thereof have relatively good stability and druggability, can form a pharmaceutical composition and a preparation thereof, and exert economic and social benefits in prevention and treatment of novel coronavirus infection; and the invention also discloses a pharmaceutical composition and application of the N4-hydroxycytidine monohydrochloride and the crystal form C of the N4-hydroxycytidine monohydrochloride. The compound is used for preparing medicines for preventing or treating symptoms or diseases caused by respiratory syncytial virus, influenza virus, chikungunya fever virus, Ebola virus, Venezuela equine encephalitis virus, Eastern or western equine encephalitis virus, coronavirus or Zika virus.

The present invention relates to recombinant modified vaccinia virus Ankara (MVA) and to methods of using the same. In particular, the invention relates to recombinant MVA comprising a nucleotide sequence encoding for a structural protein of an equine encephalitis virus (EEV) excluding encoding for a capsid protein of the EEV, a composition in particular a pharmaceutical composition, a vaccine or kit comprising the recombinant MVA, uses and methods thereof e.g., suitable for treating and/or preventing a western, Venezuelan, and/or eastern equine encephalitis virus caused disease.

The invention discloses a monoclonal antibody (EEEV-5F4) resisting an EEEV I (Eastern Equine Encephalitis Virus I) E2 protein, a B-cell epitope peptide recognized by the EEE-5F4 as well as the application of the EEEV-5F4 and the B-cell epitope peptide. The invention further discloses a hybridoma cell strain which can stably secrete the EEEV-5F4 resisting the EEEV I E2 protein and is named as EEEV-5F4. The microbial preservation number of the hybridoma cell strain is CGMCC No. 7006. An idiosyncratic reaction can occur between the EEEV-5F4 secreted by the hybridoma cell strain and the EEEV I E2 protein while the EEEV-5F4 does not react with other antigen types of EEEV antigen clusters and WEEVes/VEEVes (Western Equine Encephalitis Viruses/Venezuelan Equine Encephalitis Viruses). Secondly, the invention further discloses the B-cell epitope peptide which is specially recognized by the EEEV-5F4. The EEEV-5F4 and the specific B-cell epitope peptide, recognized by the EEEV-5F4, of the EEEV I E2 protein can be used for preparing reagents for identifying and diagnosing different antigen types of EEVA antigen clusters and lay a foundation for creating identifying and diagnosing methods of different antigen types of the EEVA antigen clusters.

The invention discloses a multiplex PCR primer and probe combination for detecting 18 pathogens and application of the multiplex PCR primer and probe combination. According to the invention, influenza A virus, influenza B virus, respiratory syncytial virus, rhinovirus, and human parainfluenza virus (differentiating type I, type II, type III, type IV, type IV, type IV, type IV, type IV, type IV, type V. A multiplex PCR (Polymerase Chain Reaction) primer and probe combination which can be used for simultaneously detecting the 18 pathogens is researched and designed by taking the 18 pathogens (type III), enterovirus, dengue virus, eastern equine encephalitis virus, western equine encephalitis virus, Venezuela equine encephalitis virus, forest encephalitis virus, Saint Lewis encephalitis virus, west Nile virus, yellow fever virus, Nipah virus and Hendea virus as targets. On the basis, a corresponding gene chip and a detection kit are developed. The primer and probe scheme designed and obtained by the invention is strong in specificity, wide in detection range and good in result accuracy, not only contributes to prevention and control of infectious pathogens, but also can be used for external quality assessment and the like of corresponding pathogens.

The invention relates to an oncolytic virus based on an equine encephalitis virus and application thereof. The oncolytic virus is a Venezuela equine encephalitis virus with a function-inactivated capsid protein gene. The oncolytic virus can also be used as an expression vector for expression of exogenous genes. The oncolytic virus has a remarkable oncolytic effect in various tumour cells and mouse tumour-bearing models; an effective anti-cancer therapeutic agent can be provided for clinical tumour treatment; and the oncolytic virus has a good application prospect.