Unlock instant, AI-driven research and patent intelligence for your innovation.

Oncolytic virus based on equine encephalitis virus and application thereof

An oncolytic virus, equine encephalitis technology, applied in the direction of viruses, viral peptides, viruses/phages, etc., to achieve good application prospects, high genetic stability, and significant oncolytic effects.

Pending Publication Date: 2021-11-30
WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, there is no report on the oncolytic virus based on equine encephalitis virus and its use in the treatment of tumors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Oncolytic virus based on equine encephalitis virus and application thereof
  • Oncolytic virus based on equine encephalitis virus and application thereof
  • Oncolytic virus based on equine encephalitis virus and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0138] Example 1: Construction of the Venezuelan Equine Encephalitis Virus (VEEV) Vaccine Strain TC-83 Infectious Clones Deleting the Capsid Protein Gene and Rescue of the Virus

[0139] In this example, an infectious clone was constructed by exploring the Venezuelan Equine Encephalitis Virus (VEEV) vaccine strain TC-83 lacking the capsid protein gene.

[0140] 1. Construction of Infectious Clones Deleting All Genes of Capsid Protein (VEEV-delC)

[0141] According to the VEEV-TC83 sequence (GenBank accession no. DQ322637.1), two primers were synthesized, whose sequences are shown in Table 1 as P3-nsp4+E3-F1 and P4-E1-R1.

[0142] Table 1. Primers used for the construction of infectious clones of VEEV vaccine strains lacking capsid protein genes

[0143] P3-nsp4+E3-F1 catcgatggcgcgccaccatgtcactagtgaccaccatgtg (SEQ ID NO 2) P4-E1-R1 caatagagtgttctcccac (SEQ ID NO 3)

[0144] The VEEV-delC fragment was amplified by PCR with PrimeSTARMAX enzyme (purchased ...

Embodiment 2

[0160] Example 2: Characteristics of VEEV-delC virus

[0161] The VEEV-delC viruses provided by the present disclosure are genetically stable.

[0162] 2.1. Comparison of VEEV-delC viral plasmid bands passaged for more than 10 generations

[0163] The VEEV-delC virus (P0 generation) rescued in Example 1 was infected with BHK-21 cells, and the cell supernatant (P1 generation) was collected after 5 days, and three viruses were passed in parallel for each generation, and this step was repeated 10 times to obtain the P10 generation. Virus. The P10 generation viruses were divided into three strains, named A strain (VEEV-delC-A-P10), B strain (VEEV-delC-B-P10) and C strain (VEEV-delC-B-P10). The P10 generation virus was further passaged to obtain B strain P11 generation (VEEV-delC-B-P11), A strain P12 generation (VEEV-delC-A-P12) and C strain P13 generation (VEEV-delC-C-P13). RNA was extracted from the cells collected from P0 and P10-P13 passages, and stored at -80°C for future u...

Embodiment 3

[0169] Example 3: Oncolysis of VEEV-delC virus on tumor cells in vitro

[0170] In this example, after infecting tumor cells with the VEEV-delC virus prepared in Example 1 at a fixed MOI dose, the killing effect of VEEV-delC on tumor cells was observed in bright field ( image 3 A), and using CCK8 to detect the killing of tumor cells by different doses of VEEV-delC to determine the in vitro oncolytic effect of the virus ( image 3 B). in:

[0171] 3.1. Bright field observation of the oncolytic effect of VEEV-delC on tumor cells

[0172] Control group (Mock): tumor cell group cultured in medium without virus

[0173] Experimental group: Tumor cell group cultured in medium with VEEV-delC virus

[0174] Eight tumor cells Huh7, A549, SKOV3, B16F1, 4T1, HELA, A375, and A2058 were divided according to 8 × 10 4 Cells / well were seeded in 12-well cell culture plates in DMEM or 1640 medium supplemented with 10% serum (FBS) at 37°C, 5% CO 2 Culture in a humidified incubator. After...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an oncolytic virus based on an equine encephalitis virus and application thereof. The oncolytic virus is a Venezuela equine encephalitis virus with a function-inactivated capsid protein gene. The oncolytic virus can also be used as an expression vector for expression of exogenous genes. The oncolytic virus has a remarkable oncolytic effect in various tumour cells and mouse tumour-bearing models; an effective anti-cancer therapeutic agent can be provided for clinical tumour treatment; and the oncolytic virus has a good application prospect.

Description

technical field [0001] The present disclosure belongs to the field of biotechnology, and the present disclosure relates to an oncolytic virus based on equine encephalitis virus and uses thereof, and more particularly, to an oncolytic virus of Venezuelan equine encephalitis virus lacking the capsid protein gene and its use as a Use of oncolytic viruses. Background technique [0002] Tumor is the biggest public health problem facing mankind and the second biggest killer of death. Malignant tumors have become one of the major public health problems that seriously threaten the health of people in China and the world. At present, there are two main types of cancer treatments, one is traditional treatment methods including chemotherapy / radiotherapy / surgery, and the other is immunotherapy based on cytokines / immune cells and antibodies. However, both traditional treatment and immunotherapy have treatment deficiencies. The biggest drawback of traditional therapy is drug resistance...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/00C12N15/40A61K35/768A61P35/00
CPCC12N7/00C07K14/005A61K35/768A61P35/00C12N2770/00021C12N2770/00022Y02A50/30
Inventor 张波刘静
Owner WUHAN INST OF VIROLOGY CHINESE ACADEMY OF SCI