Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain

A technology of recombinant strains and proline, applied in the direction of recombinant DNA technology, microorganism-based methods, bacteria, etc., can solve the problems of increasing the amount of acid and alkali, increasing the production cycle, environmental problems, etc., to increase production and reduce the discharge of three wastes , The effect of convenient separation and purification

Active Publication Date: 2016-04-13
ZHEJIANG LVCHUANG BIOTECHNOLOGY CO LTD
View PDF10 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the construction here also leads to a high concentration of L-proline in the cells. Until the end of fermentation, the concentration of L-proline in the fermentation broth is relatively high, which is about one-third of the concentration of hydroxyproline. In addition, the physical properties of L-proline and hydroxyproline are relatively similar, so it is difficult to separate and purify by simple crystallization methods, and can only be separated and purified by ion exchange resins; and the use of ion exchange resins not only increases the production cycle , and increased the amount of acid and alkali, more seriously, a large amount of acid and alkali wastewater was produced, which brought serious environmental problems and greatly increased the cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain
  • Recombination strain for producing trans-4-hydroxy-L-proline and building and application of recombination strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Cloning of L-proline hydroxylase gene and its promoter

[0032] 1. Synthesize Pxyl+proH according to the L-proline hydroxylase gene proH sequence GenBank: D78338.1 (shown in SEQ ID NO.1) and the Bacillus subtilis xylanase promoter Pxyl sequence (shown in SEQ ID NO.2) Fragment with EcoRI and KpnI sites added at both ends (shown in SEQ ID NO.3);

[0033] 2. Digest Pxyl+proH with EcoRI and KpnI, wherein, enzyme digestion system: 43 μL of DNA, 5 μL of buffer, 1 μL of each of EcoRI and KpnI, and incubate at 37°C for 3 hours. Electrophoresis detection and recovery for future use.

[0034] 3. Cultivate Escherichia coli containing the pUC18 plasmid, and extract the plasmid. The extraction method is operated according to the kit instructions. The plasmid was double-digested with EcoRI and KpnI, the restriction system was the same as above, detected by electrophoresis and recovered for later use.

[0035] 4. Use T4 ligase to connect Pxyl+proH and carrier pUC18 DN...

Embodiment 2

[0037] Embodiment 2: Cloning of L-glutamate kinase gene proB and L-glutamyl phosphate reductase gene proA gene

[0038] 1. Use the total DNA of Escherichia coli DH5α strain as a template, and use primer F-proB: TAT GGTACC AACTGCCGCTAGGCTTGCTG (shown in SEQ ID NO.4) and R-proA: GTA GGATCC CGTCAATGGCCTTGTGAATC (shown in SEQ ID NO.5) was amplified to obtain the proB+proA gene fragment. Among them, the PCR reaction system includes: template 1μL Escherichia coli genomic DNA, 1μL dNTP (10mmol / L), 2μmol / LMgCl 2 , 0.5 μmol / Lprimers, 5 μL 10×PCRbuffer, 3UKOD DNA polymerase (purchased from TOYOBO). The PCR reaction conditions include: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 55°C for 40 s, extension at 68°C for 2 min, 25 cycles; 68, 10 min.

[0039] 2. Using the operation similar to Example 1, use KpnI and BamHI to double-enzyme-cut proB+proA, connect with the same double-enzyme-digested pUC18-pxyl-proH plasmid, transform Escherichia coli DH5α...

Embodiment 3

[0040] Embodiment 3: the cloning of kanamycin resistance gene

[0041] 1. Take the template plasmid pKD4 as the template, and use the primer F-kanR:CAT GGATCC TGTAGGCTGGAGCTGCTTCG (shown in SEQ ID NO.6) and R-kanR:GAC AAGCTT ATGGGAATTAGCCATGGTCC (shown in SEQ ID NO.7) was amplified to obtain the kanamycin resistance gene fragment kanR, and the PCR conditions were the same as in Example 1.

[0042] 2. Using operations similar to Example 1, use BamHI and HindIII to double-enzyme-cut kanR, connect with the same double-enzyme-digested pUC18-pxyl-proH-proB-proA plasmid, transform Escherichia coli DH5α, and obtain a recombinant plasmid. In the present invention named "pUC18-pxyl-proH-proB-proA-kanR";

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a recombination strain for producing trans-4-hydroxy-L-proline and building and application of the recombination strain and belongs to the technical field of genetic engineering. The recombination strain for producing the trans-4-hydroxy-L-proline is identified as escherichia coli HJ which is preserved in China Center for Type Culture Collection on September 17th, 2015, and the preservation number of the escherichia coli HJ is CCTCC No. M2015550. The recombination strain has the advantages that wild glutamate kinase controlled by feedback regulation is used to enhance expression, three to-be-expressed genes and expression elements such as related initiators are integrated to the chromosome of the escherichia coli, the to-be-expressed genes can be constantly replicated along with the replication of the chromosome, extremely-high genetic stability is kept, the problem of plasmid loss is solved, effective fermentation cycle is prolonged, and the yield of hydroxyproline is increased.

Description

technical field [0001] The present invention relates to a recombinant bacterial strain producing trans-4-hydroxyl-L-proline and its construction and application, in particular to a recombinant bacterial strain for fermenting and producing trans-4-hydroxyl-L-proline and its construction method and application. Background technique [0002] Trans-4-hydroxy-L-proline, referred to as L-hydroxyproline or hydroxyproline, mainly exists in the collagen of animals, the content can reach about 10%, and its function is to strengthen the elasticity of connective tissue and toughness. In the field of food additives, hydroxyproline is often used as a beverage additive because it has a unique sweetness in a bitter taste, can improve the flavor of juice drinks, and also has skin repairing functions. In the field of cosmetic additives, because hydroxyproline has anti-oxidation and anti-radiation effects, it can eliminate oxidants and adjust the potential effect of redox state of cells, so ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12P13/24C12R1/19
Inventor储消和吴黎诚程跃生英涛徐顺清陈万河
OwnerZHEJIANG LVCHUANG BIOTECHNOLOGY CO LTD