Nucleic acid for encoding SARS-CoV-2 virus spike protein and application of nucleic acid
A spike protein, sars-cov-2 technology, applied in the field of biomedicine, can solve the problem of lack of antiviral drugs for the pathogen of new coronary pneumonia
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0035] The preparation method of Spike highly expressed new crown mRNA vaccine of the present invention, the step of preparing mRNA-Spike comprises:
[0036] Step 1, synthesizing the Spike gene fragment;
[0037] Query the Spike amino acid sequence, and then perform codon optimization according to the human preferred codon table to obtain the optimized sequence, then add an ApaI restriction site (GGGCCC) and a promoter (subgenomic promoter) upstream, and a NotI restriction site downstream (GCGGCCGC), the designed sequence is directly obtained by synthesis, and the gene sequence is shown in SEQID NO.1 in the sequence listing;
[0038] Step 2, constructing TC-83 self-replicating vector;
[0039] The self-replicating mRNA is designed based on the genome of the Venezuelan Equine Encephalitis Virus (TC83VenezuelanEquine Encephalitis Virus, VEEV) in the alphavirus family, which contains genes that encode the self-replicating components of the alphavirus, but lacks the code for maki...
Embodiment 1
[0046] The preparation of embodiment 1. vaccine mRNA-Spike;
[0047] 1.Spike gene fragment synthesis
[0048] Query the Spike (SARS-CoV-2, Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1 strain) protein gene from NCBI, then perform corresponding optimization according to human codons (shown in SEQ ID NO: 1), and add Apa I upstream Restriction site (GGGCCC) and promoter (subgenomic promoter, the sequence is ctataactctctacggctaacctgaatggactacgacatagtctagtccgccaag), Not I restriction site (GCGGCCGC) and protective base (taaggcgcgcccaccca) were added downstream, and finally the DNA sequence was directly obtained by synthesis (cloning provided by the company obtained as plasmid pUC57-Spike).
[0049] 2. Construction of TC-83 self-replicating vector
[0050] The self-replicating mRNA is designed based on the genome of the Venezuelan Equine Encephalomyelitis Virus (TC83 Venezuelan Equine Encephalitis Virus, VEEV) in the alphavirus family, which contains genes that encode th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



