Check patentability & draft patents in minutes with Patsnap Eureka AI!

Nucleic acid for encoding SARS-CoV-2 virus spike protein and application of nucleic acid

A spike protein, sars-cov-2 technology, applied in the field of biomedicine, can solve the problem of lack of antiviral drugs for the pathogen of new coronary pneumonia

Active Publication Date: 2021-01-15
成都新诺明生物科技有限公司 +1
View PDF2 Cites 15 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, there is still a lack of effective antiviral drugs against the pathogen of new coronary pneumonia, and isolation treatment, symptomatic and supportive treatment are mainly used

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nucleic acid for encoding SARS-CoV-2 virus spike protein and application of nucleic acid
  • Nucleic acid for encoding SARS-CoV-2 virus spike protein and application of nucleic acid
  • Nucleic acid for encoding SARS-CoV-2 virus spike protein and application of nucleic acid

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0035] The preparation method of Spike highly expressed new crown mRNA vaccine of the present invention, the step of preparing mRNA-Spike comprises:

[0036] Step 1, synthesizing the Spike gene fragment;

[0037] Query the Spike amino acid sequence, and then perform codon optimization according to the human preferred codon table to obtain the optimized sequence, then add an ApaI restriction site (GGGCCC) and a promoter (subgenomic promoter) upstream, and a NotI restriction site downstream (GCGGCCGC), the designed sequence is directly obtained by synthesis, and the gene sequence is shown in SEQID NO.1 in the sequence listing;

[0038] Step 2, constructing TC-83 self-replicating vector;

[0039] The self-replicating mRNA is designed based on the genome of the Venezuelan Equine Encephalitis Virus (TC83VenezuelanEquine Encephalitis Virus, VEEV) in the alphavirus family, which contains genes that encode the self-replicating components of the alphavirus, but lacks the code for maki...

Embodiment 1

[0046] The preparation of embodiment 1. vaccine mRNA-Spike;

[0047] 1.Spike gene fragment synthesis

[0048] Query the Spike (SARS-CoV-2, Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1 strain) protein gene from NCBI, then perform corresponding optimization according to human codons (shown in SEQ ID NO: 1), and add Apa I upstream Restriction site (GGGCCC) and promoter (subgenomic promoter, the sequence is ctataactctctacggctaacctgaatggactacgacatagtctagtccgccaag), Not I restriction site (GCGGCCGC) and protective base (taaggcgcgcccaccca) were added downstream, and finally the DNA sequence was directly obtained by synthesis (cloning provided by the company obtained as plasmid pUC57-Spike).

[0049] 2. Construction of TC-83 self-replicating vector

[0050] The self-replicating mRNA is designed based on the genome of the Venezuelan Equine Encephalomyelitis Virus (TC83 Venezuelan Equine Encephalitis Virus, VEEV) in the alphavirus family, which contains genes that encode th...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biological medicine, in particular to nucleic acid for encoding SARSCoV2 virus spike protein and application of the nucleic acid. Through codon optimization, the invention provides the Spike high-expression novel coronavirus mRNA vaccine based on the TC83Venezuelan Equine Encephalosis Virus (VEEV) in the alpha virus family, and the vaccine can detecta spike antibody after 14 days of inoculation in an animal experiment.

Description

technical field [0001] The invention relates to the technical field of biomedicine, in particular to a nucleic acid encoding a SARS-CoV-2 virus spike protein and its application. Background technique [0002] Novel coronavirus pneumonia is an acute infectious pneumonia. On February 11, 2020, the World Health Organization (WHO) designated its English name as Corona Virus Disease 2019 (COVID-19). The nucleocapsid of SARS-CoV-2 virus is formed by nucleocapsid protein (Nucleocapsid protein, N) wrapping single-stranded positive-strand RNA, with an outer envelope, embedded with three glycoproteins, spike protein (spike protein, S), Envelope protein (envelope protein, E) and membrane protein (membrane protein, M). Among them, the E protein and the M protein are mainly involved in the assembly process of the virus, and the S protein mainly mediates the virus invasion by binding to the host cell receptor and determines the virus tissue or host tropism. [0003] At present, there is...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/50C12N15/86A61K39/215A61K9/127A61K47/28A61P31/14
CPCA61K9/127A61K39/12A61K47/28A61K2039/53A61P31/14C07K14/005C12N15/86C12N2770/20022C12N2770/20034C12N2770/32343
Inventor 王子豪
Owner 成都新诺明生物科技有限公司
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More