Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene combination, primer and probe for detecting susceptibility to type I diabetes mellitus and application

A gene combination and diabetes technology, applied in the field of probes and uses, primers, and gene combination to detect the susceptibility of type I diabetes, can solve problems such as bad living habits and changes, and achieve high sensitivity, good repeatability and high accuracy. Effect

Inactive Publication Date: 2011-04-06
NANJING WEIYU GENETIC ENG
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The technical problem to be solved by the present invention is, by detecting a group of genes and loci related to the susceptibility of type I diabetes, using specific primers and probes, combining single nucleotide extension technology with microarray chip technology, comprehensive detection and Analyze whether the tested population carries the "type I diabetes susceptibility gene", screen out the type I diabetes susceptible population from the crowd, change bad living habits, and achieve the purpose of prevention

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] The invention is a gene combination for detecting the susceptibility of type I diabetes, which includes the combination of three genes closely related to type I diabetes: PTPN22 gene, CTLA-4 gene and VDR gene. Including the following SNP sites: rs2476601 site of PTPN22 gene, rs231775 site of CTLA-4, rs2228570 site of VDR.

[0027] The gene combination used to detect susceptibility to type I diabetes is used to design specific primer pairs and probes for the site.

[0028] The primers described in the present invention are designed for the rs2476601 site of the PTPN22 gene, the rs231775 site of CTLA-4, and the rs2228570 site of the VDR, and can be used for multiplex PCR amplification, and can amplify the above three sites at the same time. Gene fragment. Designing such primers is readily accomplished by those skilled in the art. Preferably, the primers described in the present invention have the following sequence:

[0029] For rs2476601 site: AACTGCTCCAAGGATAGATG

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene combination, a primer and a probe for detecting susceptibility to type I diabetes mellitus and an application, wherein the gene combination comprises the combination of three genes close related to the type I diabetes mellitus, including a PTPN22 gene, a CTLA-4 gene and a VDR gene, and the following SNPs (Single Nucleotide Polymorphism) loci including a locus rs2476601 of the PTPN22 gene, a locus rs231775 of the CTLA-4 gene and a locus rs2228570 of the VDR gene are comprised. By detecting a group of genes and loci related to the susceptibility to the type I diabetes mellitus, populations susceptible to the type I diabetes mellitus are screened out by synthetically detecting and analyzing whether detected populations carry susceptive genes to the type I diabetes mellitus by utilizing specific primers and probes through the combination of a single nucleotide elongation technology and a microarray chip technology, so as to achieve the purpose of prevention by changing unhealthy lifestyles.

Description

technical field [0001] The present invention relates to a gene combination, primer, probe and application, especially the gene combination, primer, probe and application for detecting type I diabetes susceptibility. Background technique [0002] Diabetes is a common and frequently-occurring disease, and its prevalence is increasing rapidly with the improvement of people's living standards, population aging and lifestyle changes. According to the World Health Organization (WHO), there are currently more than 150 million people with diabetes worldwide, and this number will double by 2025. There are 30 million diabetic patients in my country, ranking second in the world. Diabetes has become the third largest non-communicable disease in developed countries after cardiovascular disease and tumors. It brings a heavy burden to society and economy and is a worldwide public health problem that seriously threatens human health. According to the recommendations of WHO and the Interna...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 杨亚非
Owner NANJING WEIYU GENETIC ENG
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com