Detection method of hereditary variation of chicken CRBP2 gene and application thereof
A detection method and gene technology, which can be used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve the problems of lack of research and no genetic variation of chicken CRBP2 gene.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0024] The present invention will be described in detail below in conjunction with specific embodiments.
[0025] (1) Design of specific primers: for the mutation of the missense codon at position 9028 of the chicken CRBP2 gene, which may result in a single nucleotide polymorphism with changes in the composition of the coding protein, the sequence of the gallinaceous chicken published by NCBI (NC_006096.2REGION: 6957813 ..6968779) as a reference, using Primer5.0 to design PCR primers capable of amplifying the region containing the third exon (8932-9033) of the chicken CRBP2 gene, the primer sequence M is: upstream primer: ATTTCATTTATGCAGACACTA (8917-8937), Downstream primer: CAGAGATCAGAGCTGTCTAA (9134-9153). The length of the amplified fragment is 237bp. Blood samples from different strains and individuals were mixed into a DNA pool and then amplified with the pair of primers to obtain a fragment of the same size as the target fragment. After bidirectional sequencing and iden...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 