Unlock instant, AI-driven research and patent intelligence for your innovation.

Detection method of hereditary variation of chicken CRBP2 gene and application thereof

A detection method and gene technology, which can be used in biochemical equipment and methods, microbial determination/inspection, DNA/RNA fragments, etc., and can solve the problems of lack of research and no genetic variation of chicken CRBP2 gene.

Inactive Publication Date: 2013-01-02
SICHUAN AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] So far, there has been no research on the genetic variation of the chicken CRBP2 gene at home and abroad. Due to the lack of research in the field of genetic variation of the CRBP2 gene in local chicken breeds in China, the functional research of this gene locus and its genetic variation and egg production traits (such as egg production , start weight, start egg weight, etc.) research is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Detection method of hereditary variation of chicken CRBP2 gene and application thereof
  • Detection method of hereditary variation of chicken CRBP2 gene and application thereof
  • Detection method of hereditary variation of chicken CRBP2 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0024] The present invention will be described in detail below in conjunction with specific embodiments.

[0025] (1) Design of specific primers: for the mutation of the missense codon at position 9028 of the chicken CRBP2 gene, which may result in a single nucleotide polymorphism with changes in the composition of the coding protein, the sequence of the gallinaceous chicken published by NCBI (NC_006096.2REGION: 6957813 ..6968779) as a reference, using Primer5.0 to design PCR primers capable of amplifying the region containing the third exon (8932-9033) of the chicken CRBP2 gene, the primer sequence M is: upstream primer: ATTTCATTTATGCAGACACTA (8917-8937), Downstream primer: CAGAGATCAGAGCTGTCTAA (9134-9153). The length of the amplified fragment is 237bp. Blood samples from different strains and individuals were mixed into a DNA pool and then amplified with the pair of primers to obtain a fragment of the same size as the target fragment. After bidirectional sequencing and iden...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a detection method of the hereditary variation of the chicken CRBP2 gene. The method is characterized in that the method comprises the following steps: extracting the genomic DNA of a chicken blood sample; performing polymerase chain reaction (PCR) amplification on the genomic DNA, wherein the sequence of the forward primer used in the PCR amplification is ATTTCATTTATGCAGACACTA and the sequence of the reverse primer used in the PCR amplification is CAGAGATCAGAGCTGTCTAA; and performing gel electrophoresis on the obtained amplification product, taking pictures, and analyzing the electrophoresis result. The T / C polymorphism of the 9028th locus of the chicken genome is related to the egg laying traits such as egg yield, laying weight and primary egg weight. The selected single-nucleotide polymorphism (SNP) locus is used to help breeding and accelerate the breeding processes of livestock and poultry.

Description

technical field [0001] The invention relates to a detection method of gene variation, in particular to a detection method and application of chicken CRBP2 gene genetic variation. Background technique [0002] Single nucleotide polymorphisms (single nucleotide polymorphisms, SNPs) mainly refer to the polymorphism of DNA sequences caused by changes such as conversion, transversion, insertion or deletion at a specific nucleotide position in genomic DNA. Compared with other genetic markers, SNP markers, such as restriction fragment length polymorphism (re-striction fragment length polymorphism, RFLP), microsatellite markers (microsatellites or short tandem repeats, STRs), have two significant features. First, SNPs are the most widely distributed in the genome and have the most abundant genetic diversity, and many SNPs are associated with the variation of biological traits, which themselves are candidate genes or loci for the study of genetic variation. Therefore, the study of S...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 肖礼华朱庆赵小玲刘益平
Owner SICHUAN AGRI UNIV