Unlock instant, AI-driven research and patent intelligence for your innovation.

Anti-tumor nucleic acid and polypeptide and application thereof

An anti-tumor activity, tumor technology, applied in the field of genetic engineering, can solve the problem of ineffective anti-tumor drugs

Inactive Publication Date: 2013-08-28
THE CHINESE UNIVERSITY OF HONG KONG
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Studies by many laboratories have found that TBX2 / TBX3 genes are highly expressed in tumor tissues (including colon cancer, liver cancer, breast cancer, ovarian cancer, etc.) 3,4,5,6 , and at the same time, it was found that its high expression makes the existing anti-tumor drugs ineffective 7

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Anti-tumor nucleic acid and polypeptide and application thereof
  • Anti-tumor nucleic acid and polypeptide and application thereof
  • Anti-tumor nucleic acid and polypeptide and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] Construction of embodiment 1 expression plasmid

[0097] On the basis of the expression vector pET28a (Novagen, Inc.), an HA tag to facilitate immunohistochemical experiments and a TAT signal peptide to facilitate the expressed polypeptide to pass through the cell membrane were inserted.

[0098] First design a connection segment. To generate the ligated fragment, 4 sets of oligonucleotides were first synthesized and ligated end-to-end (see figure 2 ). The specific connection steps include: mixing 4 groups of oligonucleotide chains in equal proportions,

[0099] 1. TATGTATCCATATGACGTCCCAGAC (SEQ ID NO: 7)

[0100] 2. TATGCCGGCGGCAGGAAGAAGCGGAGACAGCGACGAAGAG (SEQ ID NO: 8)

[0101] 3. GATCCTCTTCGTCGCTGTCTCCGCTTC (SEQ ID NO: 9)

[0102] 4. TTCCTGCCGCCGGCATAGTCTGGGACGTCATATGGATACA (SEQ ID NO: 10);

[0103] Denature at 95°C for 10 minutes, then slowly cool down to room temperature for 6 hours, and finally form a double-stranded linker with two restriction enzyme site...

Embodiment 2

[0117] Example 2 Expression of recombinant polypeptide TAP21 in Escherichia coli

[0118] The expression vector pET28a-TAT-TAP21 was introduced into Escherichia coli BL-21(DE3), and the transformant was cultured in a volume of 3 L to express the polypeptide TAP21 and obtain endosomes. The obtained endosomes were dissolved in 50 ml of lysis buffer (8M urea, 20mM NaH 2 PO 4 , 500mM NaCl), centrifuged to obtain the supernatant. Then, the His-tagged polypeptide TAP21 was purified by Ni column (Qiagen) and PD10 column (GE) chromatography (see Figure 4 ). Coomassie blue staining showed that the molecular weight of the polypeptide was about 9kDa, and the purity was about 95% (see Figure 5 ).

Embodiment 3

[0119] Example 3 Inhibition of tumor cell growth by polypeptide TAP21

[0120] The biological activity of the polypeptide TAP21 was detected in vitro. MTT (USB) detection method was used to detect cell proliferation, first 3X10 3 Liver tumor cells BEL7404 and HepG2 (ATCC) were inoculated into 96-well culture plates, and after culturing for one day, different concentrations were added (specific concentrations such as Image 6 A and 6B) TAP21 polypeptide and inactivation mutant TAP21 (TAPm, SEQ ID NO: 17), and PBS was used as a control (control). One day later, add MTT to the well to be tested, select a wavelength of 490nm to detect the absorbance value, and record the result. Draw the cell growth curve with the concentration as the abscissa and the absorbance as the ordinate, and the results are as follows Image 6 A and 6B are shown. In another experiment, the culture medium containing 20 μM polypeptides (TAP21 and TAPm) was changed every day, and PBS was used as a control...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides anti-tumor polypeptide or derivatives thereof, and a nucleic acid molecule encoding the polypeptide or the derivatives thereof. The nucleotide sequence of the polypeptide is from cDNA fragments of high-expression TBX2 and TBX3 in various tumor cells. The invention also provides a method for producing the polypeptide by using an expression vector, and application of the nucleic acid molecule, the polypeptide and the vector in inhibiting tumors or blocking tumor cells from propagating.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a tumor-suppressing polypeptide drug and its application. Background technique [0002] Antineoplastic drugs are one of the hot issues that have been widely concerned and studied for a long time. The current treatment of tumors or cancers is usually a combination of surgical treatment combined with radiotherapy and chemotherapy. Radiation and chemotherapy drugs cause apoptosis, which kills tumor cells. High-dose radiotherapy and chemotherapy drugs can destroy or eliminate cancer cells, but at the same time damage normal cells, reduce the immune function of patients, and cause a series of toxic and side effects on the human body. [0003] Peptide drugs are currently the most growing new field in the field of biomedicine. With their high efficiency, safety, and strong specificity, they are gradually used in the prevention and treatment of cancer and infect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/63C12N1/15C12N1/19C12N1/21C12N5/10C07K14/47A61K48/00A61K38/17A61K31/7088A61P35/00
Inventor 何明亮孔祥復董琦陈缨
Owner THE CHINESE UNIVERSITY OF HONG KONG