An ubiquitin ligase and the application thereof

A technology of ubiquitin ligase and protein, applied in the field of ubiquitin ligase and its application, can solve the problems that have not been verified or confirmed.

Inactive Publication Date: 2011-08-31
SINOGENOMAX
View PDF2 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, whether all RING proteins are associated with ubiquitin-proteasome has not been verified or confirmed, and a large number of further experimental studies are needed to verify this aspect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An ubiquitin ligase and the application thereof
  • An ubiquitin ligase and the application thereof
  • An ubiquitin ligase and the application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Cloning of the cDNA of embodiment 1, RNF122 gene

[0075] Through bioinformatics analysis, a two-step RT-PCR technique was used to amplify the target gene.

[0076] (1) Search the refseq database of NCBI for human unknown functional gene sequence, obtain the human unknown functional gene sequence, and use the Human_est database to perform sequence correction by BLASTn method, and finally obtain the sequence: SEQID NO: 1 (RNF122 gene, please refer to figure 1 Shown, its coded amino acid sequence please refer to SEQ ID NO: 2 and figure 2 shown). Design specific primers for gene RNF122 according to these sequences:

[0077] Upstream primer (5'-3'): CATTGATGCACCCATTCCAGTG (SEQ ID NO: 3);

[0078] Downstream primer (5'-3'): TTCTCAGGTCTCGGTGTAGCG (SEQ ID NO: 4).

[0079] (2) Using the above primers, select a template from the existing cDNA library and tumor library according to the expression profile of the target gene, and perform initial amplification. The existing li...

Embodiment 2

[0089] Example 2. Construction of pEGFP-N1-RNF122 and pEGFP-N1-RNF122-ΔTM plasmids

[0090] RNF122 was amplified from pcDB-RNF122 with specific primers (upstream primer (5'-3'): CTCGAGATGCACCCATTCCAGTG (SEQ ID NO: 5); downstream primer (5'-3'): TTCTCCAGGTCTCGGTGTAGCG (SEQ ID NO: 6) fragment, remove the termination code at the same time, and introduce Xho I and BamH I restriction sites, cut the EGFP-N1 vector with corresponding restriction enzymes, connect with T4 ligase, and obtain the fusion expression vector pEGFP-N1-RNF122 of GFP-RNF122 (see image 3 shown). Using primer 5'-CCC CTC GAG AGG ATG AGC AAA CTG CGG AACCA-3' (SEQ ID NO: 7) and primer 5'-CGG GGA TCC ACC ACC AGC TCA TCC AAT AGA-3' (SEQ ID NO: 8) , using pEGFP-N1-RNF122 as a template, PCR amplified the target fragment, after the product was recovered by agarose gel electrophoresis, the recovered fragment was digested with Xho I and BamH I, purified and combined with pEGFP treated with Xho I and BamH I -N1 carrier c...

Embodiment 3

[0091] Example 3, Construction of eukaryotic expression plasmids RNF122C92A-myc and RNF122C95A-myc

[0092] Mutant RNF122 was constructed by PCR-based site-directed mutagenesis. The primers used were P1: 5'-CCGCTC GAG ATG CAC CCA TTC CAG TGG TG-3' (SEQ ID NO: 9), P2: 5'-CGC GGA TCCGGC ACC AGC TCA TCC AAT AGA AT-3' (SEQ ID NO: 10), P3: 5'-AG ACC GCAGTC TGT-3' (SEQ ID NO: 11), P4: 5'-ACA GAC TGC GGT CT-3' (SEQ ID NO: 12), P5: 5'-A GTC CTG GAA GAC TT-3' (SEQ ID NO: 13) and P6: 5'-AA GTCTTC CAG GAC T-3' (SEQ ID NO: 14); where the box marks the introduced mutation site.

[0093] Such as Figure 5 As shown, RNF122C92A-myc uses pcDB-RNF122 as a template, first uses P1 and P4 as primers to amplify, uses P3 and P2 as primers to amplify, and recovers the mixed products of the two; using this as a template, uses P1 and P2 as primers to carry out Amplify, recover and purify, use Xho I and BamH I to cut and recover the product and purify it, then connect it to the pcDB vector, tra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an ubiquitin ligase and the application thereof, the ubiquitin ligase is protein described as follows: protein composed of amino acid sequence shown as the SEQ ID NO:2; Or protein composed of amino acid sequence shown as the SEQ ID NO:2 with replacement, deletion and / or adding one or more amino acids and has a same ubiquitin ligase activity with the amino acid sequence shown as the SEQ ID NO:2. The invention also provides a method for preparing the ubiquitin ligase, And also provides polynucleotides of amino acid sequence for coding the ubiquitin ligase protein, gene engineering carrier comprising the polynucleotides, host cells, Also provides antibody specially combined with the ubiquitin ligase, And applications of the ubiquitin ligase, the polynucleotides, the carrier and the antibody are also provided.

Description

technical field [0001] The present invention relates to a new ubiquitin ligase and its application. The present invention also relates to a preparation method of the ubiquitin ligase, a gene encoding the ubiquitin ligase, a vector containing the gene, and a host cell. Antibodies to ubiquitin ligases, and uses thereof. Background technique [0002] Endoplasmic reticulum-associated degradation (ER-associated degradation, ERAD) is an important quality control process in cells, which is very important for maintaining the homeostasis of cells. During this process, some molecular chaperones in the endoplasmic reticulum first recognize misfolded proteins or other proteins that need to be degraded, and then complete the degradation of such proteins with the participation of ubiquitin-proteasome. [0003] Ubiquitin-proteasome is the major pathway for the targeted degradation of normal, misfolded cytoplasmic or membrane proteins in eukaryotic cells. The ubiquitin-proteasome system i...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C12N15/52C12N15/63C12N1/19C12N1/21C12N5/10C07K16/40A61K48/00A61K39/395A61K38/43A61P35/00
Inventor石太平彭智邓唯唯李娜郭帅马大龙
OwnerSINOGENOMAX