An ubiquitin ligase and the application thereof
A technology of ubiquitin ligase and protein, applied in the field of ubiquitin ligase and its application, can solve the problems that have not been verified or confirmed.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0074] Cloning of the cDNA of embodiment 1, RNF122 gene
[0075] Through bioinformatics analysis, a two-step RT-PCR technique was used to amplify the target gene.
[0076] (1) Search the refseq database of NCBI for human unknown functional gene sequence, obtain the human unknown functional gene sequence, and use the Human_est database to perform sequence correction by BLASTn method, and finally obtain the sequence: SEQID NO: 1 (RNF122 gene, please refer to figure 1 Shown, its coded amino acid sequence please refer to SEQ ID NO: 2 and figure 2 shown). Design specific primers for gene RNF122 according to these sequences:
[0077] Upstream primer (5'-3'): CATTGATGCACCCATTCCAGTG (SEQ ID NO: 3);
[0078] Downstream primer (5'-3'): TTCTCAGGTCTCGGTGTAGCG (SEQ ID NO: 4).
[0079] (2) Using the above primers, select a template from the existing cDNA library and tumor library according to the expression profile of the target gene, and perform initial amplification. The existing li...
Embodiment 2
[0089] Example 2. Construction of pEGFP-N1-RNF122 and pEGFP-N1-RNF122-ΔTM plasmids
[0090] RNF122 was amplified from pcDB-RNF122 with specific primers (upstream primer (5'-3'): CTCGAGATGCACCCATTCCAGTG (SEQ ID NO: 5); downstream primer (5'-3'): TTCTCCAGGTCTCGGTGTAGCG (SEQ ID NO: 6) fragment, remove the termination code at the same time, and introduce Xho I and BamH I restriction sites, cut the EGFP-N1 vector with corresponding restriction enzymes, connect with T4 ligase, and obtain the fusion expression vector pEGFP-N1-RNF122 of GFP-RNF122 (see image 3 shown). Using primer 5'-CCC CTC GAG AGG ATG AGC AAA CTG CGG AACCA-3' (SEQ ID NO: 7) and primer 5'-CGG GGA TCC ACC ACC AGC TCA TCC AAT AGA-3' (SEQ ID NO: 8) , using pEGFP-N1-RNF122 as a template, PCR amplified the target fragment, after the product was recovered by agarose gel electrophoresis, the recovered fragment was digested with Xho I and BamH I, purified and combined with pEGFP treated with Xho I and BamH I -N1 carrier c...
Embodiment 3
[0091] Example 3, Construction of eukaryotic expression plasmids RNF122C92A-myc and RNF122C95A-myc
[0092] Mutant RNF122 was constructed by PCR-based site-directed mutagenesis. The primers used were P1: 5'-CCGCTC GAG ATG CAC CCA TTC CAG TGG TG-3' (SEQ ID NO: 9), P2: 5'-CGC GGA TCCGGC ACC AGC TCA TCC AAT AGA AT-3' (SEQ ID NO: 10), P3: 5'-AG ACC GCAGTC TGT-3' (SEQ ID NO: 11), P4: 5'-ACA GAC TGC GGT CT-3' (SEQ ID NO: 12), P5: 5'-A GTC CTG GAA GAC TT-3' (SEQ ID NO: 13) and P6: 5'-AA GTCTTC CAG GAC T-3' (SEQ ID NO: 14); where the box marks the introduced mutation site.
[0093] Such as Figure 5 As shown, RNF122C92A-myc uses pcDB-RNF122 as a template, first uses P1 and P4 as primers to amplify, uses P3 and P2 as primers to amplify, and recovers the mixed products of the two; using this as a template, uses P1 and P2 as primers to carry out Amplify, recover and purify, use Xho I and BamH I to cut and recover the product and purify it, then connect it to the pcDB vector, tra...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
