VHZ for diagnosis and treatment of cancers

A cancer and lung cancer technology, applied in the fields of medicine, cell biology, molecular biology and genetics, can solve problems such as unknown effects

Active Publication Date: 2011-09-07
AGENCY FOR SCI TECH & RES
View PDF70 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] However, the role of VHZ is largely unknown; although it is evolut

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • VHZ for diagnosis and treatment of cancers
  • VHZ for diagnosis and treatment of cancers
  • VHZ for diagnosis and treatment of cancers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 27

[0605] Example 27 shows that animals treated with anti-VHZ antibodies showed significantly fewer tumors compared to animals not treated with anti-VHZ antibodies. Anti-VHZ antibodies are capable of binding to block VHZ polypeptide activity.

[0606] Thus, we provide the use of anti-VHZ antibodies in the treatment or prevention of diseases such as cancer. Cancer can include metastatic cancer. Anti-VHZ antibodies can be used as a drug or therapy to treat cancer metastases, such as established tumors. They can be used to prevent cancer or its metastasis.

[0607] Treatable or preventable cancers may include cancers associated with the expression or overexpression of VHZ proteins. VHZ proteins may be related members of the family. By this we mean that cancers associated with the expression or overexpression of VHZ are treatable or preventable by anti-VHZ antibodies such as 209 or antibodies with similar or identical properties. Similarly, cancers associated with the expression...

Embodiment 1

[0690] Example 1: Generation of VHZ-EGFP, VHZ(C95S)-EGFP, VHZ-GST, and VHZ(C95S)-GST Expression Constructs

[0691] The Human Universal Rapid Clone II cDNA library (BD, catalog number 637260) was used as template in the generation of the VHZ fragment. PCR (94, 55, 72°C, 40 cycles) was performed using forward primer A: 5'gcgaattcaccatgggcgtgcagccccccaacttctcc3' and reverse primer B: 5'gtggatcccgtttcgttcgctggtag3'. The VHZ PCR fragment was then inserted into the EcoRI and BamHI sites of the pEGFP-N1 vector to generate a C-terminal EGFP-tagged VHZ (VHZ-EGFP). To construct VHZ(C95S), the above forward primer A and reverse primer B were used in a similar strategy as previously described (Zeng et al. 2003) together with the middle reverse primer 5' gccaaagcccagagcagagtgcactcccacagc3' and the middle forward primer 5' gcgaattcaccatgggcgtgcagccccccaacttctcc3' to make catalytically inactive VHZ (C95S). Then the VHZ(C95S) PCR fragment was inserted into the EcoRI and BamHI sites of the ...

Embodiment 2

[0692] Example 2: Generation of MCF-7 and NRK cell pools stably expressing VHZ-EGFP, VHZ-EGFP(C95S) and EGFP vectors alone

[0693] Lipofectamine 2000 (Invitrogen) was used to transfect the three expression constructs into human breast cancer cell line MCF-7 (ATCC HTB-22) or normal rat kidney cells NRK (ATCC CRL-6509), respectively. Cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 2 mM L-glutamine (Invitrogen). Cells were selected in 1 mg / ml G418 for 20-30 days to establish stable cell pools. Then the stable set (10 6 cells / ml) for EGFP sorting to select EGFP-positive cells.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

We provide VHZ for use in a method of treatment, prophylaxis or alleviation of a cancer in an individual selected from the group consisting of: colon cancer, lung cancer, squamous cell carcinoma including lip, larynx, vulva, cervix and penis cancer, pancreatic cancer, brain cancer, oesophageal cancer, stomach cancer, bladder cancer, kidney cancer, skin cancer, ovary cancer, prostate cancer and testicular cancer. We provide an anti-VHZ agent for the treatment, prophylaxis or alleviation of such a cancer. The anti-VHZ agent may comprise SEQ ID NO:4 or SEQ ID NO: 5, or both.

Description

field of invention [0001] The present invention relates to the fields of medicine, cell biology, molecular biology and genetics. The present invention relates to the field of medicine. [0002] Specifically, it relates to diseases such as colon cancer, lung cancer, squamous cell carcinoma including lip, larynx, vulva, cervix and penis cancer, pancreatic cancer, brain cancer, esophagus cancer, stomach cancer, bladder cancer, kidney cancer, skin cancer Cancer, ovarian cancer, prostate cancer and testicular cancer treatment and diagnosis, and compositions for such use. Background of the invention [0003] VHZ is a phosphatase that shares approximately 28% amino acid sequence identity with human PRL-PTP. It was previously reported that VHZ is expressed in many tissues and localized in the cytosol and nucleolus (Alonso et al., 2004a). [0004] However, the role of VHZ is largely unknown; although it is evolutionarily conserved with its orthologues in frogs, fish, flies, and Ar...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): A61K31/7105A61K39/395A61K31/711A61P35/00
CPCA61K31/711A61K31/7105C07K16/40A61K2039/505C07K2316/96C07K16/30C07K2317/24A61P1/10A61P11/10A61P13/10A61P13/12A61P15/10A61P17/00A61P35/00A61P35/02A61P35/04C07K2317/73A61K39/3955A61K39/39558
Inventor 曾琦
Owner AGENCY FOR SCI TECH & RES
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap