VHZ for diagnosis and treatment of cancers
A cancer and lung cancer technology, applied in the fields of medicine, cell biology, molecular biology and genetics, can solve problems such as unknown effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 27
[0605] Example 27 shows that animals treated with anti-VHZ antibodies showed significantly fewer tumors compared to animals not treated with anti-VHZ antibodies. Anti-VHZ antibodies are capable of binding to block VHZ polypeptide activity.
[0606] Thus, we provide the use of anti-VHZ antibodies in the treatment or prevention of diseases such as cancer. Cancer can include metastatic cancer. Anti-VHZ antibodies can be used as a drug or therapy to treat cancer metastases, such as established tumors. They can be used to prevent cancer or its metastasis.
[0607] Treatable or preventable cancers may include cancers associated with the expression or overexpression of VHZ proteins. VHZ proteins may be related members of the family. By this we mean that cancers associated with the expression or overexpression of VHZ are treatable or preventable by anti-VHZ antibodies such as 209 or antibodies with similar or identical properties. Similarly, cancers associated with the expression...
Embodiment 1
[0690] Example 1: Generation of VHZ-EGFP, VHZ(C95S)-EGFP, VHZ-GST, and VHZ(C95S)-GST Expression Constructs
[0691] The Human Universal Rapid Clone II cDNA library (BD, catalog number 637260) was used as template in the generation of the VHZ fragment. PCR (94, 55, 72°C, 40 cycles) was performed using forward primer A: 5'gcgaattcaccatgggcgtgcagccccccaacttctcc3' and reverse primer B: 5'gtggatcccgtttcgttcgctggtag3'. The VHZ PCR fragment was then inserted into the EcoRI and BamHI sites of the pEGFP-N1 vector to generate a C-terminal EGFP-tagged VHZ (VHZ-EGFP). To construct VHZ(C95S), the above forward primer A and reverse primer B were used in a similar strategy as previously described (Zeng et al. 2003) together with the middle reverse primer 5' gccaaagcccagagcagagtgcactcccacagc3' and the middle forward primer 5' gcgaattcaccatgggcgtgcagccccccaacttctcc3' to make catalytically inactive VHZ (C95S). Then the VHZ(C95S) PCR fragment was inserted into the EcoRI and BamHI sites of the ...
Embodiment 2
[0692] Example 2: Generation of MCF-7 and NRK cell pools stably expressing VHZ-EGFP, VHZ-EGFP(C95S) and EGFP vectors alone
[0693] Lipofectamine 2000 (Invitrogen) was used to transfect the three expression constructs into human breast cancer cell line MCF-7 (ATCC HTB-22) or normal rat kidney cells NRK (ATCC CRL-6509), respectively. Cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum and 2 mM L-glutamine (Invitrogen). Cells were selected in 1 mg / ml G418 for 20-30 days to establish stable cell pools. Then the stable set (10 6 cells / ml) for EGFP sorting to select EGFP-positive cells.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
