Supercharge Your Innovation With Domain-Expert AI Agents!

Tumor cell microsatellite instable state complex amplification system and detection kit

A technology of microsatellite instability and amplification system, which is applied in the field of compound amplification system and detection kit for the unstable microsatellite state of tumor cells, and can solve problems such as difficulty

Active Publication Date: 2011-11-02
BEIJING MICROREAD GENE TECH
View PDF1 Cites 66 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0016] Finding quasi-monomorphic sites with high sensitivity and specificity for detecting MSI is a necessary work to establish an MSI detection system, and has become a hot spot in the field of MSI detection in recent years, but this work is not easy. So far Only one product from Promega can detect 5 at a time, and it is imperative to develop an MSI detection system with more sites and better sensitivity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tumor cell microsatellite instable state complex amplification system and detection kit
  • Tumor cell microsatellite instable state complex amplification system and detection kit
  • Tumor cell microsatellite instable state complex amplification system and detection kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0096] The following is the specific implementation of the detection of a patient with colorectal cancer by using the present invention. At the same time, the sample was used as a control with the MSI Analysis Systemv1.2 kit of Promega Company, and the operation method was carried out according to the supporting operation guide (TM255).

[0097] 1. DNA extraction

[0098] The tissue DNA extraction kit (Tiangen Biochemical) was used to extract DNA from the patient's cancer tissue and normal tissue. The operation steps were in accordance with the instructions.

[0099] 2.PCR

[0100] 2.1 Reaction system:

[0101] A total of 9 pairs of primers for the AMEL locus and 8 quasi-monomorphic STR loci were dissolved respectively and made into a working solution with a concentration of 10uM, and then made into a primer mix (Primer mix) according to the volume ratio in Table 2:

[0102] NR-21 primer:

[0103] Primer 1: GAGTCGCTGGCACAGTTCTA,

[0104] Primer 2: CTGGTCACTCGCGTTTACAA;

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention relates to a tumor cell microsatellite instable state complex amplification system and a detection kit and belongs to the field of biotechnology. In the invention, 8 quasi-monomorphic nucleotide repeated loci with high sensitivity and specificity (including NR-21, NR-22, NR-24, NR-27, BAT-25, BAT-26, MONO-27 and CAT-25) are selected to detect microsatellite instability (MSI). Meanwhile, an amelo (AMEL) is added and a 9-loci multiplex amplification system is constructed, so the result is more accurate. The addition of the gender determining locus can prevent an experiment operator from mixing up samples and delivering wrong results to a certain extent. In the invention, the operation is simple, and large-scale promotion is convenient. With the success of the development of the kit, the method can be used for batch production; the use conditions of the method can be modularized; automatic equipment is applied in the whole process, so the whole process is independent of theoperational experiment of people; and the total detection time is about 6 hours.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a multiple amplification system and a detection kit for disease diagnosis, in particular to a multiple amplification system and a detection kit for tumor cell microsatellite instability, which can quickly predict the occurrence of tumors. Background technique [0002] Colorectal cancer (CRC) is a common malignant tumor that occurs in the colon or rectum. In the past 20 years, the incidence of colorectal cancer (mainly colon cancer) in most countries in the world has been on the rise. The rising trend of the incidence of colorectal cancer in China is also very obvious. The age of onset in China is mostly 40-60 years old, and the peak is around 50 years old, but colorectal cancer patients under 30 years old are not uncommon. An important feature of this disease in China is that the median age of onset of colorectal cancer is about ten years earlier in China than in Europe and the United...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
Inventor 陈初光周仲春覃健
Owner BEIJING MICROREAD GENE TECH
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More