Tumor cell microsatellite instable state complex amplification system and detection kit
A technology of microsatellite instability and amplification system, which is applied in the field of compound amplification system and detection kit for the unstable microsatellite state of tumor cells, and can solve problems such as difficulty
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0096] The following is the specific implementation of the detection of a patient with colorectal cancer by using the present invention. At the same time, the sample was used as a control with the MSI Analysis Systemv1.2 kit of Promega Company, and the operation method was carried out according to the supporting operation guide (TM255).
[0097] 1. DNA extraction
[0098] The tissue DNA extraction kit (Tiangen Biochemical) was used to extract DNA from the patient's cancer tissue and normal tissue. The operation steps were in accordance with the instructions.
[0099] 2.PCR
[0100] 2.1 Reaction system:
[0101] A total of 9 pairs of primers for the AMEL locus and 8 quasi-monomorphic STR loci were dissolved respectively and made into a working solution with a concentration of 10uM, and then made into a primer mix (Primer mix) according to the volume ratio in Table 2:
[0102] NR-21 primer:
[0103] Primer 1: GAGTCGCTGGCACAGTTCTA,
[0104] Primer 2: CTGGTCACTCGCGTTTACAA;
...
PUM
Property | Measurement | Unit |
---|---|---|
Sensitivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com