Constant-temperature amplification method of double-labeled nucleic acid and detection test strip
A technology for constant temperature amplification and detection of test strips, applied in biochemical equipment and methods, microbial determination/inspection, DNA preparation, etc., can solve problems such as endangering the health of operators, unable to exclude false positives, and restricting the promotion and use of LAMP technology. Achieve high specificity, high speed, and low molecular biology technical requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Example 1: Shigella in food ( Shigella ) specific gene iP Amplification method and detection test strip
[0034] 1. Shigella specific genes in food iP Amplification method
[0035] (1) Primer design and labeling
[0036] The 232-437 nucleotide sequence of the Shigella specific gene ipaH was screened out by consulting the literature and using BLAST software analysis, and the eight sites of the fragment (these eight sites were: 233-254bp, 256-273 bp, 275-294 bp, 302-323bp, 341-362bp, 363-382bp, 386-405bp and 420-438bp) LAMP primers were designed and synthesized. The primer design was completed by LAMP special primer design software, and the following primers were obtained:
[0037] Forward Outer Primer F3-ipaH 5'-CATGGCTGGAAAAACTCAGTGC-3'
[0038] Reverse outer primer B3-ipaH 5'-GAGGCGGAACATTTCCCTG-3'
[0039] forward inner primer
[0040] FIP-ipaH 5'-TCCTCACAGCTCTCAGTGGCATTTTTCTGCGGAGCTTCGACAG-3'
[0041] reverse inner primer
[0042] BIP-ipaH 5'-ATCTCCGG...
Embodiment 2
[0054] Example 2: Macrobrachium rosenbergii Nodavirus (MrNV) RNA-2 amplification method and detection test strip.
[0055] 1. Amplification Method of Macrobrachium rosenbergii Nodavirus RNA-2
[0056] (1) Primer design and labeling
[0057] By consulting the literature and analyzing with BLAST software, the Macrobrachium rosenbergii Nodavirus-specific gene fragment RNA-2 was screened out, targeting at eight sites of this fragment (these eight sites are: 1976-1994bp, 1997-2007bp, 1997-2007bp, 2007-2032bp, 2057-2076bp, 2107-2136bp, 2171-2147bp, 2195-2178bp and 2198-2216bp) LAMP primers were designed and synthesized. The primer design was completed by LAMP-specific primer design software, and the following primers were obtained:
[0058] Forward Outer Primer F3-RNA-2 5'-CCAATATGAACCGGGAGTG-3'
[0059] Reverse outer primer B3-RNA-2 5'- GGGTTCAACCTTGAGTTCC-3'
[0060] forward inner primer
[0061] FIP-RNA-2 5'- TCAGCCTAACTGCTGCGTATTTTTGG TTAAGAGTGGTAGTCCAA-3'
[0062] rever...
Embodiment 3
[0074] Example 3: Trypanosoma brucei in human and animal blood ( Trypanosoma brucei gambiense ) Amplification method of gene fragment 5.8S-ITS2 and detection test strip.
[0075] 1. Amplification method of trypanosoma brucei gene fragment 5.8S-ITS2 in human and animal blood
[0076] (1) Primer design and labeling
[0077] Trypanosoma brucei (T. Trypanosoma brucei gambiense ) gene fragment 5.8S-ITS2, LAMP primers were designed and synthesized for the six sites of this fragment, the primer design was completed by LAMP special primer design software, and the following primers were obtained:
[0078] Forward Outer Primer F3-5.8S-ITS2 5'- AAGCTCTCTCGAGCCATC-3'
[0079] Reverse Outer Primer B3-5.8S-ITS2 5'- TGACATACACAATATGTGCGA-3'
[0080] Forward internal primer FIP-5.8S-ITS2
[0081] 5'- GCGTTGAACAACACAAAATAGGTGATGCCACATTTCTCAGTGT-3'
[0082] reverse inner primer
[0083] BIP-5.8S-ITS2 5'-CCACCTCTTCTCTCGTGTGGAAGAAAGAGATGAAAGATATCGTA-3'.
[0084] The 5' ends of the ab...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 