Unlock instant, AI-driven research and patent intelligence for your innovation.

Constant-temperature amplification method of double-labeled nucleic acid and detection test strip

A technology for constant temperature amplification and detection of test strips, applied in biochemical equipment and methods, microbial determination/inspection, DNA preparation, etc., can solve problems such as endangering the health of operators, unable to exclude false positives, and restricting the promotion and use of LAMP technology. Achieve high specificity, high speed, and low molecular biology technical requirements

Inactive Publication Date: 2012-01-25
HENAN ACAD OF AGRI SCI
View PDF1 Cites 23 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, electrophoresis and turbidimetry are often used to detect LAMP products, which requires the use of highly carcinogenic fluorescent dye ethidium bromide, which not only endangers the health of operators, but also cannot rule out the problem of false positives, which limits the promotion and use of LAMP technology.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constant-temperature amplification method of double-labeled nucleic acid and detection test strip
  • Constant-temperature amplification method of double-labeled nucleic acid and detection test strip
  • Constant-temperature amplification method of double-labeled nucleic acid and detection test strip

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Example 1: Shigella in food ( Shigella ) specific gene iP Amplification method and detection test strip

[0034] 1. Shigella specific genes in food iP Amplification method

[0035] (1) Primer design and labeling

[0036] The 232-437 nucleotide sequence of the Shigella specific gene ipaH was screened out by consulting the literature and using BLAST software analysis, and the eight sites of the fragment (these eight sites were: 233-254bp, 256-273 bp, 275-294 bp, 302-323bp, 341-362bp, 363-382bp, 386-405bp and 420-438bp) LAMP primers were designed and synthesized. The primer design was completed by LAMP special primer design software, and the following primers were obtained:

[0037] Forward Outer Primer F3-ipaH 5'-CATGGCTGGAAAAACTCAGTGC-3'

[0038] Reverse outer primer B3-ipaH 5'-GAGGCGGAACATTTCCCTG-3'

[0039] forward inner primer

[0040] FIP-ipaH 5'-TCCTCACAGCTCTCAGTGGCATTTTTCTGCGGAGCTTCGACAG-3'

[0041] reverse inner primer

[0042] BIP-ipaH 5'-ATCTCCGG...

Embodiment 2

[0054] Example 2: Macrobrachium rosenbergii Nodavirus (MrNV) RNA-2 amplification method and detection test strip.

[0055] 1. Amplification Method of Macrobrachium rosenbergii Nodavirus RNA-2

[0056] (1) Primer design and labeling

[0057] By consulting the literature and analyzing with BLAST software, the Macrobrachium rosenbergii Nodavirus-specific gene fragment RNA-2 was screened out, targeting at eight sites of this fragment (these eight sites are: 1976-1994bp, 1997-2007bp, 1997-2007bp, 2007-2032bp, 2057-2076bp, 2107-2136bp, 2171-2147bp, 2195-2178bp and 2198-2216bp) LAMP primers were designed and synthesized. The primer design was completed by LAMP-specific primer design software, and the following primers were obtained:

[0058] Forward Outer Primer F3-RNA-2 5'-CCAATATGAACCGGGAGTG-3'

[0059] Reverse outer primer B3-RNA-2 5'- GGGTTCAACCTTGAGTTCC-3'

[0060] forward inner primer

[0061] FIP-RNA-2 5'- TCAGCCTAACTGCTGCGTATTTTTGG TTAAGAGTGGTAGTCCAA-3'

[0062] rever...

Embodiment 3

[0074] Example 3: Trypanosoma brucei in human and animal blood ( Trypanosoma brucei gambiense ) Amplification method of gene fragment 5.8S-ITS2 and detection test strip.

[0075] 1. Amplification method of trypanosoma brucei gene fragment 5.8S-ITS2 in human and animal blood

[0076] (1) Primer design and labeling

[0077] Trypanosoma brucei (T. Trypanosoma brucei gambiense ) gene fragment 5.8S-ITS2, LAMP primers were designed and synthesized for the six sites of this fragment, the primer design was completed by LAMP special primer design software, and the following primers were obtained:

[0078] Forward Outer Primer F3-5.8S-ITS2 5'- AAGCTCTCTCGAGCCATC-3'

[0079] Reverse Outer Primer B3-5.8S-ITS2 5'- TGACATACACAATATGTGCGA-3'

[0080] Forward internal primer FIP-5.8S-ITS2

[0081] 5'- GCGTTGAACAACACAAAATAGGTGATGCCACATTTCTCAGTGT-3'

[0082] reverse inner primer

[0083] BIP-5.8S-ITS2 5'-CCACCTCTTCTCTCGTGTGGAAGAAAGAGATGAAAGATATCGTA-3'.

[0084] The 5' ends of the ab...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a constant-temperature amplification method of double-labeled nucleic acid and a test strip. The constant-temperature amplification method comprises the following steps of: adding labeled primers into an LAMP (loop-mediated isothermal amplification) reaction system for constant-temperature amplification by firstly synthesizing inner primers, outer primers and ring primers and using biotin and fluorescein to label the inner primers or / and the ring primers, and obtaining a constant-temperature amplification product of the double-labeled nucleic acid. The test strip comprises a supporting layer and a nucleic acid amplification product adsorbing layer which is pasted on the supporting layer; and the biotin affinity protein and fluorescein isothiocyanate antibody are used for printing a detection mark and a control mark on a cellulose layer. In the test strip disclosed by the invention, the detection specificity is strong, the sensitivity is high, the speed is high,not only can the LAMP product be intuitively detected, but also the defect that the specificity of the detection test paper of the colloidal gold is lower can be overcome. The invention can be widelyused for detection of specific genes in various pathogenic microorganisms or pathogens.

Description

technical field [0001] The invention relates to a ring-mediated isothermal amplification method and a test strip, in particular to a double-labeled nucleic acid amplification method and a rapid detection test strip. Background technique [0002] With the development of modern molecular biology and molecular technology, many nucleic acid amplification techniques have been researched and developed. Among them, the nucleic acid loop-mediated isothermal amplification technology (loop-mediated isothermal amplification, LAMP), due to its strong specificity, high sensitivity, and fast reaction speed, has a tendency to replace PCR in the field of nucleic acid-specific amplification and detection. It has become one of the research hotspots in the field of life sciences. The main principle of nucleic acid circle-mediated amplification is based on designing 2 pairs of specific primers for the 6 regions of the target sequence, using a strand-displacing DNA polymerase (Bst DNA polymeras...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/10C12Q1/68C12Q1/70C12Q1/04
Inventor 张改平王德国邓瑞广郭军庆李学伍邢广旭赵东
Owner HENAN ACAD OF AGRI SCI