Constant-temperature amplification method of double-labeled nucleic acid and detection test strip
A technology of test strips and markings, applied in biochemical equipment and methods, microbiological measurement/inspection, DNA preparation, etc., can solve the problems of restricting the promotion and use of LAMP technology, endangering the health of operators, and being unable to rule out false positives, etc., to achieve High speed, high specificity, high sensitivity effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Shigella in food ( Shigella ) specific gene iP Amplification method and detection test strip
[0030] 1. Shigella specific genes in food iP Amplification method
[0031] (1) Primer design and labeling
[0032] The 232-437 nucleotide sequence of the Shigella specific gene ipaH was screened out by consulting the literature and using BLAST software analysis, and the eight sites of the fragment (these eight sites were: 233-254bp, 256-273 bp, 275-294 bp, 302-323bp, 341-362bp, 363-382bp, 386-405bp and 420-438bp) LAMP primers were designed and synthesized. The primer design was completed by LAMP special primer design software, and the following primers were obtained:
[0033] Forward Outer Primer F3-ipaH 5'-CATGGCTGGAAAAACTCAGTGC-3'
[0034] Reverse outer primer B3-ipaH 5'-GAGGCGGAACATTTCCCTG-3'
[0035] forward inner primer
[0036] FIP-ipaH 5'-TCCTCACAGCTCTCAGTGGCATTTTTCTGCGGAGCTTCGACAG-3'
[0037] reverse inner primer
[0038] BIP-ipaH 5'-ATCTCCGG...
Embodiment 2
[0050] Example 2: Listeria monocytogenes in food ( Listeria monocytogenes ) specific gene wxya Amplification method and detection test strip.
[0051] (1) Primer design and labeling
[0052] Listeria monocytogenes-specific genes were screened by literature review and BLAST software analysis wxya Sequence, LAMP primers were designed and synthesized for this fragment, the primer design was completed by LAMP special primer design software, and the following primers were obtained:
[0053] Forward Outer Primer F3- wxya 5’-CTGGTTACACTAAATATGTATTTGC-3’
[0054] Reverse Outer Primer B3- wxya 5'-GCCGTGGATGTTATCGTAT-3'
[0055] forward inner primer
[0056] FIP- wxya 5’-AGGTTTTGCTTGAGATTCAGAGATTTTTTAATCTCCCTTCCACGTACT-3’
[0057] reverse inner primer
[0058] BIP - wxya 5’-TTGACTATGGTAGCGGAATTTCTCTTTTTTAACGCCATTGTCTTGC-3’
[0059] Forward loop primer LF- wxya 5'-GTAGTGCTAGCGTATTGTGCG-3'
[0060] Reverse loop primer LB- wxya 5'-GGTATCTACGTTGGTAATGGT...
Embodiment 3
[0069] Example 3: Salmonella in food ( Salmonella ) specific gene invA Amplification method and detection test strip.
[0070] (1) Primer design and labeling
[0071] Salmonella-specific genes were screened out by reviewing the literature and analyzing with BLAST software invA Sequence, LAMP primers were designed and synthesized for this fragment, the primer design was completed by LAMP special primer design software, and the following primers were obtained:
[0072] Forward outer primer F3- invA 5’-CTGGGCGTTTTTTTTGTCCTG-3’
[0073] Reverse outer primer B3- invA 5’-GGGAAGGTTAAGGAGGGTGA-3’
[0074] forward inner primer
[0075] FIP - invA 5’-GCGAGGTTTGGCGGCTGATATTTTTCGCGACGACAAAATCTGG-3’
[0076] reverse inner primer
[0077] BIP - invA 5'- AACTTTAGCGCAAGGTGCCTCTTTTTGCCGGTAAACTACACGATGA -3'
[0078] Forward loop primer LF- invA 5’-AGGCTTCGCGTACAGAGG-3’
[0079] Reverse loop primer LB- invA 5’-CACGTCAGCAAAGCGTACC-3’
[0080] The 5' ends of ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com