Check patentability & draft patents in minutes with Patsnap Eureka AI!

In-vitro separation method of porcine teschovirus

A technology of porcine Jieshen virus and isolation method, which is applied in the field of veterinary biology, can solve the problems of difficult separation and purification of porcine Jieshen virus, and achieve the effect of high specificity, strong sensitivity, and specific separation and purification

Inactive Publication Date: 2012-07-04
BEIJING DABEINONG TECH GRP CO LTD +1
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In clinical practice, porcine Jieshen virus is mixed with other viruses to infect pigs, and Jieshen virus is the same as the common clinical porcine disease virus, and can be passaged in pig kidneys such as IBRS-2 cells, PK-15 cells, and ST cells. It grows on the cell line, and the cytopathy produced is not particularly typical, so it brings certain difficulties to the isolation and purification of porcine Jieshen virus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In-vitro separation method of porcine teschovirus
  • In-vitro separation method of porcine teschovirus
  • In-vitro separation method of porcine teschovirus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1 Collection and treatment of diseased pig feeds infected with porcine Teshen virus

[0028] (1) Collection of sick materials

[0029] The diseased pigs with diarrhea symptoms and neurological symptoms were selected, and the cerebellum tissue of the diseased pigs infected with porcine Teshen virus was clinically confirmed.

[0030] (2) Treatment of sick materials:

[0031] About 1 g of diseased material was ground with 5 mL of culture medium. Repeat freeze-thaw 3 times, centrifuge at 12,000 rpm for 10 minutes, take the supernatant, discard the precipitate, and store below -40°C.

Embodiment 2

[0032] Example 2 Identification of disease materials by nRT-PCR

[0033] Take 250 μL of the diseased material treated in Example 1, and use an RNA extraction kit for RNA extraction.

[0034] Reverse transcription was performed with the reverse transcription primer CCAGCCGCGACCCTGTCAGGCAGCAC (SEQ ID No. 2). Reverse transcription system: total RNA 100ng, 15pmol primer, 1mM dNTP, 200U M-MLV, 1×buffer, 20U RNase inhibitor, supplemented with DEPC water to 20μL system, and reacted at 42°C for 1h.

[0035] The reverse transcribed cDNA is used for nested PCR amplification of the 5' untranslated region of the genome with the following primers:

[0036] First-round PCR upstream primer: AGTTTTGGATTATCTTGTGCCC (SEQ ID No. 1);

[0037] Downstream primer: CCAGCCGCGACCCTGTCAGGCAGCAC (SEQ ID No. 2);

[0038] The upstream primer of the second round of PCR: TGAAAGACCTGCTCTGGCGCGAG (SEQ ID No. 3);

[0039] Downstream primer: GCTGGTGGGCCCCCAGAGAAATCTC (SEQ ID No. 4).

[0040] The expected fr...

Embodiment 3

[0044] Example 3 Passaging of porcine Teshin virus

[0045] 1 mL of the supernatant of the disease material identified as positive according to Example 2 was inoculated into PK-15 cells (T25 cell flasks) that had grown into monolayers, incubated at 37°C for 1 h, and then replaced with 7 mL of 2% DMEM, and the CPE was observed daily. See figure 2 , image 3 , for 5 consecutive days. If there is no CPE, it can be continued to pass for 5 generations. In each generation, the supernatant is taken at the time of drug collection, and the method of Example 2 is used for nRT-PCR detection: if it is positive, it will continue to pass, and if it is negative, it will be discarded.

[0046] Cells with more than 90% lesions were frozen and thawed once, centrifuged at 12,000 rpm for 10 min, and the supernatant was taken and stored at -80°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention provides an in-vitro separation method of porcine teschovirus. The in-vitro separation method comprises the following steps of: (1) acquiring specimen supernatant which is identified to be positive by nRT-PCR (nested Reverse Transcription-Polymerase Chain Reaction) and subjected to sterile filtration from a swine specimen which is clinically diagnosed to be doubtful porcine teschovirus infection; (2) infecting a swine kidney passage cell line with the acquired specimen supernatant, and carrying out continuous passage culture until more than 90% cells are subjected to pathologic change, wherein supernatant is taken and subjected to nRT-PCR detection when viruses are collected in each generation, and the PCR-positive virus liquid is maintained for keeping passage; and (3) purifying the porcine teschovirus after passage culture in the step (2) by use of a plaque purification method. The separation purification method provided by the invention is high in specificity and strong in sensitivity and can be used for quickly and specifically separating and purifying porcine teschovirus.

Description

technical field [0001] The invention belongs to the field of veterinary biotechnology, and in particular relates to an in vitro separation method of porcine zeshin virus. Background technique [0002] Porcine infectious encephalomyelitis, also known as porcine Teschovirus, is caused by Porcine Teschovirus (PTV), which can cause diarrhea, respiratory symptoms, porcine poliomyelitis, reproductive disorders, pneumonia, diarrhea, pericardium It is a viral infectious disease with various manifestations such as inflammation, myocarditis, and skin damage, which seriously endangers the pig industry. [0003] Porcine Teshen virus, originally belonging to the family Picorna, belongs to the genus Enterovirus. In 1999, the Virus Taxonomy Committee listed 11 serotypes of Enterovirus as the genus of Teshen virus. In clinical practice, swine Jieshen virus is mixed with other viruses to infect pigs, and Jieshen virus, like common clinical swine disease virus, can be passaged in IBRS-2 cell...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N7/00C12N7/02
Inventor 宫晓文王美君张志榜赵亚荣
Owner BEIJING DABEINONG TECH GRP CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More