Osteoporosis susceptible gene non-invasive detection kit
A technology of osteoporosis and detection kit, applied in the field of molecular biology, can solve problems such as acceleration of osteoporosis
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1. Use of detection kits
[0023] 1. Extract DNA template
[0024] The epithelial cells of the oral mucosa of the subjects were scraped, and the genomic DNA was extracted by the phenol-chloroform method.
[0025] 2. PCR amplification reaction
[0026] Use the PCR reaction component in the detection kit, which contains the following primer pairs:
[0027] (1) IL-6 (G-174C) forward primer: 5′CAAGACATGCCAAAGTGCTGA 3′
[0028] IL-6 (G-174C) reverse primer: 5′ATCTTTGTTGGAGGGTGAGGG 3′
[0029] (2) VDR (Bsm I) forward primer: 5'CACGGAGAAGTCACTGGAGG3'
[0030] VDR (Bsm I) reverse primer: 5'TCTCATTGCCAAACACTTCG3'
[0031] (3) VDR (TaqI) forward primer: 5'AATACCTACTTTGCTGGTTTGC3'
[0032] VDR (TaqI) reverse primer: 5'CTCCCTCTTCTCACCTCTAACC3'
[0033] (4) TNF-a (G-308A) forward primer: 5'GGAAGCCAAGACTGAAACCA3'
[0034] TNF-a (G-308A) reverse primer: 5'TCATCTGGAGGAAGCGGTAG3'
[0035] (5) OPG (Lys3Asn) forward primer: 5'CTGTTGCCGGGACGCTAT3'
[0036] OPG (Lys3Asn) r...
Embodiment 2
[0054] Example 2. Services for non-invasive detection of osteoporosis prevention genes for people
[0055] 1. Sampling and DNA extraction
[0056] The physicians in the laboratory department of the hospital will guide the subjects to use oral swabs to sample oral epithelial cells, and use the phenol-chloroform method to extract DNA from oral epithelial cells
[0057] 2. Genotype detection
[0058] Using the kit provided by the invention, the IL-6 gene G-174C (rs1800795) of the subject's genomic DNA, BsmI (rs731236) and TaqI (rs1544410) on the VDR gene, G-308A (rs1800629) on the TNF-a gene ), the five single nucleotide polymorphism sites of Lys3Asn (rs2073618) on the OPG gene were subjected to DNA sequencing respectively, and the genotypes of these five SNPs sites were determined.
[0059] 3. Risk assessment of women at high risk of osteoporosis
[0060] Through the analysis of the SNPs genotype of the subjects, an osteoporosis risk assessment and analysis report is issued. ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com