Yeast engineering bacterial strain capable of producing glutathione and application thereof to production of glutathione

A technology of glutathione and yeast engineering, applied in the direction of fermentation, fungi, microorganisms, etc., to achieve the effects of promoting cell growth and product synthesis, increasing yield and yield, and improving utilization capacity

Active Publication Date: 2012-07-11
SHANDONG UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] VHb has been successfully used to increase the yield of target products in a variety of microorganisms, but so far there is no report on the use of VHb to increase the yield of glutathione produced by fermentation of Saccharomyces cerevisiae

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast engineering bacterial strain capable of producing glutathione and application thereof to production of glutathione
  • Yeast engineering bacterial strain capable of producing glutathione and application thereof to production of glutathione
  • Yeast engineering bacterial strain capable of producing glutathione and application thereof to production of glutathione

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Construction of Saccharomyces cerevisiae integration vector expressing VHb

[0040] 1. Acquisition of the vgb sequence of the hemoglobin gene of Vitreum hyalineus. Use the vector pYES3 / CT-vgb as a template to amplify the target gene vgb, and the primers are:

[0041] Upstream primer: 5′GGCGCAGATCTATGTTAGACCAGCAAAC3′

[0042] Downstream primer: 5'GGCAGATCTTTATTCAACCGCTTGAGC3'

[0043] The 5' of the primers are all introduced into the Bgl II restriction site. Amplification conditions are: ①95°C, 5min; ②94°C, 30s; ③56°C, 30s; ④72°C, 1min; ⑤cycle 30-35 times; ⑥72°C, 10min.

[0044] 2. Digest the vgb fragment and the vector pYMIKP with Bgl II, and then connect with T4 DNA ligase.

[0045] 3. The ligation product was transformed into Escherichia coli TOP10 competent cells, positive clones were screened, and the recombinant plasmid pYM-vgb was identified by PCR and DNA sequencing analysis, and finally the recombinant expression plasmid pYM-vgb was obtained (for ...

Embodiment 2

[0046] Embodiment 2: Contain the construction of VHb genetically engineered bacteria

[0047] The correctly sequenced recombinant plasmid pYM-vgb in Example 1 was digested and linearized with restriction endonuclease Kpn I, and the digested product was purified by ethanol precipitation, recovered and used for electrotransformation. The specific method is as follows:

[0048] (1) Inoculate a single colony of the yeast strain used for transformation into 5 ml of YPD medium, and culture overnight at 30°C and a shaker speed of 220r / min until saturation;

[0049] (2) Inoculate an appropriate amount of overnight culture solution in 50ml of YPD medium until the OD600 is about 1.3-1.5; harvest the cultured cells by centrifugation at 4°C and 3000r / min, and resuspend the cells in 100ml of sterile water;

[0050] (3) Add an appropriate amount of 1mol / L dithiothreitol (DTT, used to loosen the cell wall) solution, rotate and shake at the same time, and shake gently at 30°C for 15 minutes;...

Embodiment 3

[0063] Embodiment 3: Fermentation experiment of genetically engineered bacteria

[0064] The original strain and the recombinant strain obtained in Example 2 were respectively inoculated into 250 ml Erlenmeyer flasks containing 50 ml of YPD liquid medium, cultured overnight at 30° C., and the shaker speed was 220 r / min. The cultivated seed medium was inoculated into a 250 ml Erlenmeyer flask containing 100 ml of fermentation medium with an inoculum amount of 2%, and cultivated at 30° C. for 28 hours, and the shaker speed was 220 r / min. After the fermentation, the content of glutathione was determined by the Alloxan method (Shanghai Medical Laboratory. Clinical Biochemical Test [M]. Shanghai Science and Technology Publishing, 1979, 86-88.). The fermentation results showed that: the liquid volume of 100ml was not enough for the 250ml Erlenmeyer flask, which could not meet the oxygen demand of the yeast during the growth process. The output of the original strain in 100ml fermen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a yeast engineering bacterial strain capable of producing glutathione, which has the bacterial strain name of 101-V and the classification name of Saccharomyces cerevisiae strain collected in the China General Microbiological Culture Collection Center on February 15, 2012, with the collection number of CGMCC NO. 5758. The invention also discloses a method for establishing an engineering bacterial strain capable of producing glutathione at a high yield. The method comprises the following steps: integrating a Vitreoscilla hemoglobin gene vgb into a yeast genome capable of producing glutathione, and screening to obtain a recombinant yeast capable of expressing transparent Vitreoscilla hemoglobin gene. Therefore, the oxygen utilizing capability of the hemoglobin gene recombinant strainis improved in a molecular level, the contradiction between supply and demand of oxygen in the microbiological fermenting process is solved, the consumption of oxygen and energy is lowered, and the yield of glutathione is increased.

Description

technical field [0001] The invention relates to a glutathione-producing yeast engineering bacterium, its construction method, and its application in the production of glutathione. Background technique [0002] Glutathione (glutathione, GSH), also known as γ-L-glutamyl-L-cysteinyl-glycine, is a biologically active three Peptide compounds widely exist in animal, plant and microbial cells. Fermentation method is more and more popular because it can use cheap raw materials to synthesize glutathione through specific microbial metabolism, simple operation, low cost and fast production rate (Meister A, Anderson M E. Glutathione[J]. Ann Rev Biochem, 1983, 52: 711-760. Li Y, Wei G Y, Chen J, Glutathione: a review on biotechnological production [J] Appl Microbiol Biotechnol, 2004, 66(3): 233-242). The physiological functions of GSH mainly include the following aspects: (1) Anti-free radical damage to cells: excessive free radicals produced by the body's metabolism can damage biofilm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/81C12P21/02C12R1/865
Inventor王凤山董坤陈晓燕朱希强
OwnerSHANDONG UNIV