Supercharge Your Innovation With Domain-Expert AI Agents!

Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof

A coding and coding sequence technology, applied in the direction of transferase, application, genetic engineering, etc., can solve problems such as economic loss, fast epidemic speed, and short disease cycle

Inactive Publication Date: 2013-04-10
SHANDONG AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Capsicum blight is a devastating disease with a wide distribution worldwide in the cultivation and production of peppers. The disease has a short onset period and a fast epidemic speed, which brings serious economic losses to production.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof
  • Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof
  • Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Embodiment 1, the cloning of carnitine fatty acyltransferase PCCAT1 gene and the pathogenicity of PCCAT1

[0060] 1. PCCAT1 gene cloning

[0061] Design of primers for cloning Phytophthora capsici carnitine acyltransferase PCCAT1 gene:

[0062] CAT-1F: ATGCTGCACGCGTCCCGCTCCC, CAT-1R: TTATTTCTTGGGAGTGGTGTCGGCGAGC. Using the genomic DNA of Phytophthora capsici strain SD33 (Shandong Agricultural University) (J. Phytopathol 157:585-591, 2009) as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered and combined with pGEM-T Easy Vector ( Promega) connection, and transformed into Escherichia coli DH5α, positive clones were screened through blue-white screening and enzyme digestion identification of plasmid DNA, and the plasmids of positive clones were extracted for sequencing. The sequencing results showed that the nucleotide sequence of the PCR product was listed in the sequence list. The sequence 1 of the coding se...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a carnitine acyltransferase PCCAT1 from Phytophthora capsici, and a coding gene and application thereof. The carnitine acyltransferase PCCAT 1 disclosed by the invention is the following protein a) or b): a) protein composed of an amino acid sequence disclosed as Sequence 2 in the sequence table; b) a)-derived protein related to Phytophthora capsici pathogenicity, which issubstitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence disclosed as Sequence 2 in the sequence table. The invention provides supporting technology for further development of Phytophthora capsici molecule detection technique, and control and research of multiple plant diseases caused by Phytophthora capsici.

Description

technical field [0001] The invention relates to a carnitine fatty acyltransferase, its coding gene and application, in particular to the carnitine fatty acyltransferase from Phytophthora capsici and its coding gene and application. Background technique [0002] Phytophthora capsici Leonian belongs to the phylum Fungi, the subphylum Flagellate, the class Oomycetes, and the order Peronomycetes. Phytophthora capsici is a pathogenic fungus with a wide range of hosts, in addition to infecting peppers, it also infects other crops. Zhou Qiming et al. reported infecting 21 species of cultivated plants and weeds in 9 families; Ren Guangchi et al. found that the fungus can harm eggplant, cucumber, tomato, cowpea, kidney bean, cabbage, cabbage, radish, carrot, peach, apricot, apple, etc. It is weakly infective to onions and garlic, and does not infect citrus and potato stems and leaves. It is the most pathogenic to pepper. [0003] Pepper blight is a soil-borne disease caused by Phy...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12N1/19C12N1/21C12N1/13C12N1/15C12N5/10C12Q1/68C12Q1/48C12N15/11C12R1/645
Inventor 张修国
Owner SHANDONG AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More