Carnitine acyltransferase PCCAT1 from Phytophthora capsici, and coding gene and application thereof
A coding and coding sequence technology, applied in the direction of transferase, application, genetic engineering, etc., can solve problems such as economic loss, fast epidemic speed, and short disease cycle
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Embodiment 1, the cloning of carnitine fatty acyltransferase PCCAT1 gene and the pathogenicity of PCCAT1
[0060] 1. PCCAT1 gene cloning
[0061] Design of primers for cloning Phytophthora capsici carnitine acyltransferase PCCAT1 gene:
[0062] CAT-1F: ATGCTGCACGCGTCCCGCTCCC, CAT-1R: TTATTTCTTGGGAGTGGTGTCGGCGAGC. Using the genomic DNA of Phytophthora capsici strain SD33 (Shandong Agricultural University) (J. Phytopathol 157:585-591, 2009) as a template, PCR amplification was carried out with the above primers, and the amplified products were recovered and combined with pGEM-T Easy Vector ( Promega) connection, and transformed into Escherichia coli DH5α, positive clones were screened through blue-white screening and enzyme digestion identification of plasmid DNA, and the plasmids of positive clones were extracted for sequencing. The sequencing results showed that the nucleotide sequence of the PCR product was listed in the sequence list. The sequence 1 of the coding se...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
