Unlock instant, AI-driven research and patent intelligence for your innovation.

Promoter for regulation of gene expression in plant roots

A promoter and plant technology, applied to the regulation of gene expression in plants, the field of gene expression regulation, can solve the problem of not being able to provide the root specificity of the selected gene

Inactive Publication Date: 2012-09-05
SYNGENTA PARTICIPATIONS AG
View PDF22 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Other promoters do not provide the root specificity required to express the selected gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter for regulation of gene expression in plant roots
  • Promoter for regulation of gene expression in plant roots
  • Promoter for regulation of gene expression in plant roots

Examples

Experimental program
Comparison scheme
Effect test

example 1

[0141] Example 1: Construction of a root cap-specific expression cassette

[0142] entry carrier

[0143] The first step in the construction of the expression cassette is to clone the promoter into an entry vector. PCR primers were designed to amplify the promoter and terminator from maize line B73. These isolated nucleic acid sequences were TOPO cloned and sequenced. The promoter corresponding to this sequence was named the maize root shoot specific 1 promoter or ZmRCP1-1 promoter. The terminator corresponding to this sequence was named maize root shoot specific 1 terminator or ZmRCP1-terminator.

[0144] The ZmRCP1-1 promoter was amplified using maize genomic DNA (B73) as template in a 50 μL Extensor (AB Genetics) DNA polymerase reaction containing: 10 μg gDNA, 5 μL 10X Extensor buffer 1, 2.0 μL 10 mM dNTP mix , 1.0 μL of 20 μM prRCP Forward - SEQ ID NO: 9 (5'GCTAGCCTCGAGGGACCCAACAATTTGCCACAAACTGG-3'), 1.0 μL of 20 μM RCP P2 Reverse - SEQ ID NO: 10 (5'-GCTAGCGGATCCGGCGCC...

example 2

[0157] Example 2: Construction of a root cap-specific expression cassette

[0158] entry carrier

[0159] The first step in the construction of the expression cassette is to clone the promoter into an entry vector. PCR primers were designed to amplify the promoter from maize line B73. These isolated nucleic acid sequences were TOPO cloned and sequenced. The promoter corresponding to this sequence was named as maize root shoot specific 1-2 promoter or ZmRCP1-2 promoter.

[0160] The vector is PCR4-Topo, which contains a putative maize root cap specific promoter prZmRCP1-2. prZmRCP1-2 was amplified by PCR from the genomic DNA of maize B73 using primers AG971f-SEQ ID NO: 11 (CTCGAGGGACCCAACAATTTGCCACAAACTGG) and AG972r-SEQ ID NO: 12 (GGATCCTGTAGACTGCTCTGGCTTAA), then cloned into PCR4-Topo and Sequencing. The resulting vector was pSYN15670 (SEQ ID NO: 21).

example 3

[0161] Example 3: Expression of GUS in Stably Transformed Maize Directed by a Root-Specific Promoter

[0162] Maize plants were transformed with an Agrobacterium vector comprising the ZmRCP1 promoter and terminator of the present invention operably linked to the GUS coding sequence. The Agrobacterium vector further includes a ubiquitin promoter and NOS terminator operably linked to the PMI (phosphomannose isomerase) coding sequence.

[0163] GUS activity in stably transformed maize was measured by visual assay. GUS activity was characterized as high (+++), moderate (++), low (+), or none (-), and the data for 25 low copy transgenic maize plants per promoter construct were averaged. The results shown in Table 1 demonstrate that GUS activity is specifically restricted to roots in transgenic plants comprising an expression cassette comprising a promoter of the present invention. This expression was further defined as sequestration into the root cap.

[0164] Table 1. Summary G...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention is directed to a promoter isolated from maize. The promoter of the invention have particular utility in driving root preferred expression, specifically root-cap expression, of heterologous genes that impart increased agronomic, horticultural and / or pesticidal characteristics to a given transgenic plant. The invention is also drawn to DNA molecules comprising the promoter of the invention and transformed plant tissues containing DNA molecules comprising a promoter of the invention operably linked to a heterologous gene or genes, and seeds thereof.

Description

Field of Invention [0001] The present invention generally relates to the field of plant molecular biology and the regulation of gene expression in plants. The present invention discloses nucleotide sequences from Maize (maize) that include a regulatory element, such as a promoter. More specifically, the present invention relates to the regulation of root-cap-specific gene expression in plant roots. Background of the Invention [0002] Manipulation of crop plants to alter and / or improve phenotypic characteristics such as yield or quality requires expression of heterologous genes in plant tissue. Such genetic manipulation is made possible by two discoveries: the ability to transform heterologous genetic material into plant cells, and the presence of promoters capable of promoting expression of the heterologous genetic material. [0003] It is advantageous to have a variety of different promoter choices to give the desired effect in transgenic plants. Appropriate promoters c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07H21/02C12P21/06
CPCC07K14/415C12N15/8227
Inventor T·朱V·C·克拉默A·T·里克蒙德
Owner SYNGENTA PARTICIPATIONS AG