Alpha-1, 3 galactosyl transferase fusion protein and preparation method thereof

A fusion protein and galactose-based technology, applied in the biological field, can solve the problems of environmental pollution, poor effect, time-consuming and labor-intensive, etc., and achieve the effect of good industrial application prospects

Active Publication Date: 2012-10-03
BEIJING JING MENG STEM CELL TECH
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although protein refolding and denaturation methods can be used to change the insoluble and inactive state of proteins, it is time-consuming, laborious, ineffective and pollutes the environment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-1, 3 galactosyl transferase fusion protein and preparation method thereof
  • Alpha-1, 3 galactosyl transferase fusion protein and preparation method thereof
  • Alpha-1, 3 galactosyl transferase fusion protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Cloning of the α-1,3-galactosyltransferase gene

[0036] Using methods known to those skilled in the art, the α-1,3 galactosyltransferase gene sequence that we cloned is shown in SEQ ID No.1, the corresponding α-1,3 galactosyltransferase gene sequence The amino acid sequence of the transferase is shown in SEQ ID No.2. For the convenience of subsequent cloning, a restriction endonuclease site such as NdeI was added upstream of the gene, and a BamHI site was added downstream of the gene.

Embodiment 2

[0038] Construction of α-1,3-galactosyltransferase expression clone

[0039] The α-1,3 galactosyltransferase gene cloned in the above Example 1 was introduced into restriction endonuclease NdeI and BamHI restriction endonuclease sites by PCR method, and the upstream primer sequence used was: 5'GAATACCATATGGAAAGCAAGCTTAAGCTATCG3' ; The downstream primer sequence is: 5'GAAGGATCCTTATCAGACATTATTTCTAAC3'. The recovered PCR product and pET-15b plasmid vector were digested with NdeI (NEB) and BamHI (NEB) restriction endonucleases for 3 hours; the vector was recovered after agarose gel electrophoresis to detect the digestion effect and Gene fragments; under the action of T4DNA ligase (NEB), connect the vector and the gene; add the ligated product directly to the competent E. coli DH5α melted in ice bath, incubate for 30 minutes and then heat shock transformation in 42°C water bath; The finally screened transformants were sequenced to verify the expression clone of α-1,3 galactosyltra...

Embodiment 3

[0041] Construction of expression clones fused with α-1,3 galactosyltransferase and TRX

[0042]The α-1,3-galactosyltransferase gene cloned in the above-mentioned Example 1 was introduced into restriction endonucleases KpnI and XhoI restriction sites by PCR, and the upstream primer sequences used were:

[0043] 5'GAATACGGTACCGAAAGCAAGCTTAAGCTATCG3' (sequence shown in SEQ ID No.4);

[0044] The downstream primer sequences are:

[0045] 5'GAACTCGAGTTATCAGACATTATTTCTAAC3' (sequence shown in SEQ ID No.4);

[0046] Both the recovered PCR product and the pET-32a plasmid vector were digested with KpnI and XhoI restriction endonucleases for 3 hours; the vector and gene were recovered after detecting the digestion effect by agarose gel electrophoresis; ligated in T4DNA Under the action of the enzyme (NEB), the vector and the gene were connected; the ligation product was directly added to the competent E. coli DH5α melted in an ice bath, incubated for 30 minutes and then transformed b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an alpha-1, 3 galactosyl transferase fusion protein and a preparation method thereof. The alpha-1, 3 galactosyl transferase fusion protein provided by the invention comprises TRX (thioredoxin) and catalyzes the formation of an alpha-galactose epitope. The invention also provides a bacterium for generating the alpha-1, 3 galactosyl transferase fusion protein. The fusion protein provided by the invention completely has the activity of alpha-1, 3 galactosyl transferase, is expressed in a soluble way, further, is higher in expression quantity, occupies above 20% of a soluble bacterial crackate, and has a favorable industrial application prospect.

Description

technical field [0001] The invention belongs to the biological field and relates to a glycosyltransferase, in particular to an alpha-1,3 galactosyltransferase fusion protein, which catalyzes the formation of alpha-galactose epitopes. Background technique [0002] α-1,3 galactosyltransferase exists in some animals such as cattle, mice, etc., but humans do not have this enzyme. The enzyme forms an α-1,3-galactosyl group on a specific substrate and becomes an epitope that can be recognized by antibodies naturally present in the human body. This epitope is usually called an α-galactose epitope; this is The biological basis of immune rejection in human allografts, therefore, α-1,3 galactosyltransferase can be used to synthesize anti-immune rejection drugs. [0003] Later studies found that human tumor cells modified by this enzyme can be more effectively recognized by the autoimmune system, and then eliminated more effectively. Such modified cells or cell fragments are therefore...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/10C12N1/21C12N15/62C12N15/70C12R1/19
Inventor蔡传奇郭海军闫宇鹏云升王云虹
OwnerBEIJING JING MENG STEM CELL TECH