Molecular motor biosensor kit for detecting salmonella

A biosensor and molecular motor technology, applied in the field of rapid detection of food microorganisms, can solve the problems of time-consuming and labor-intensive, increasing laboratory workload, affecting the quality of goods and shelf life, etc., and achieving high-throughput detection, high sensitivity and specificity. strong effect

Inactive Publication Date: 2015-03-18
PEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU +1
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Traditional pathogen detection methods require non-selective enrichment, selective enrichment, separation, screening, and identification for each inspection item. It usually takes 5 days to issue a test report, which seriously affects the quality and shelf life of the goods.
Some new technologies such as PCR technology, immunological detection technology, biochip technology and other detection methods still rely on traditional detection steps, that is, they need to be enriched, which is time-consuming and labor-intensive. It usually takes several days to complete a detection
This not only increases the workload of the laboratory, but also is not conducive to the monitoring of the production process in the food industry, the quality control of the final product, and the management and control of food safety by government departments.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular motor biosensor kit for detecting salmonella
  • Molecular motor biosensor kit for detecting salmonella
  • Molecular motor biosensor kit for detecting salmonella

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0007] The specific nucleic acid probe 5'gtgaaattatcgccacgttcgggcaa was designed according to the Salmonella invA gene, wherein the 5' of the probe was labeled with biotin. The probe is connected to the molecular motor through the biotin antibody, and the DNA of the sample to be tested can be detected by using the molecular motor biosensor. When the sample is Salmonella DNA, the fluorescence value of the detection system will change significantly. Through this Changes can be used to judge the sample as positive. For this reason, we have designed a kit that can detect Salmonella in food conveniently and quickly.

[0008] Kit composition:

[0009] serial number

[0010] The operation steps are as follows:

[0011] 1. Take a 1.5ml EP tube and add 10μl of the sample to be tested.

[0012] 2. Put the above EP tube into boiling water for 3 minutes, then immediately transfer to ice to cool down completely.

[0013] 3. Take 2μl of chro invA and dilute to a certain multi...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A molecular motor biosensor kit for detecting salmonella belongs to the field of food microorganism rapid detection, and mainly solves the problem of a long period (5-6 days) for traditional detection methods. The core technology of the invention is that since F0F1-ATP synthase can rotate rapidly, coupling between catalytic sites and proton transport is established through rotation by using the F0F1-ATPase molecular motor biosensor on a chromatophore. Firstly, an invA probe is connected with an epsilon subunit of the ATP synthase; a sample to be detected and a negative control are respectively combined with the biosensor; the ATP yield after the catalysis of ATP synthesis for 30 min is compared; the amount of ATP synthesis can be measured by the H+ amount in the environment, and the amount of H+ can be obtained by fluorescence intensity reflected by H-DHPE. The kit of the invention can rapidly and sensitively detect salmonella in samples to be detected with high throughput.

Description

technical field [0001] The invention relates to a rapid detection technology for food microorganisms. Background technique [0002] Traditional pathogen detection methods require non-selective enrichment, selective enrichment, separation, screening, and identification for each inspection item. It usually takes 5 days to issue a test report, which seriously affects the quality and shelf life of the goods. Some new technologies such as PCR technology, immunological detection technology, biochip technology and other detection methods still rely on traditional detection steps, that is, they need to be enriched, which is time-consuming and labor-intensive. It usually takes several days to complete a detection. This not only increases the workload of the laboratory, but also is not conducive to the monitoring of the production process in the food industry, the quality control of the final product, and the management and control of food safety by government departments. Due to the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68C12Q1/42C12Q1/04C12R1/42C12R1/63C12R1/19C12R1/01
Inventor张捷顾德周张惠媛王佩荣乐加昌陈广全
OwnerPEOPLES REPUBLIC OF CHINA BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU