Molecular motor biosensor kit for detecting salmonella
A biosensor and molecular motor technology, applied in the field of rapid detection of food microorganisms, can solve the problems of time-consuming and labor-intensive, increasing laboratory workload, affecting the quality of goods and shelf life, etc., and achieving high-throughput detection, high sensitivity and specificity. strong effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0007] The specific nucleic acid probe 5'gtgaaattatcgccacgttcgggcaa was designed according to the Salmonella invA gene, wherein the 5' of the probe was labeled with biotin. The probe is connected to the molecular motor through the biotin antibody, and the DNA of the sample to be tested can be detected by using the molecular motor biosensor. When the sample is Salmonella DNA, the fluorescence value of the detection system will change significantly. Through this Changes can be used to judge the sample as positive. For this reason, we have designed a kit that can detect Salmonella in food conveniently and quickly.
[0008] Kit composition:
[0009] serial number
[0010] The operation steps are as follows:
[0011] 1. Take a 1.5ml EP tube and add 10μl of the sample to be tested.
[0012] 2. Put the above EP tube into boiling water for 3 minutes, then immediately transfer to ice to cool down completely.
[0013] 3. Take 2μl of chro invA and dilute to a certain multi...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com