Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

A gene amplification and mitochondrial technology, which is applied in DNA preparation, recombinant DNA technology, DNA / RNA fragments, etc., can solve the problems of amplifying mitochondria that have never been reported, and achieve the promotion of development, strong amplification ability, and wide amplification range effect

Active Publication Date: 2013-05-01
ZHEJIANG OCEAN UNIV
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, no universal primers have been reported to amplify mitochondrial COⅢ and ND3 gene sequences, especially for gobies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Goby mitochondrion COIII and ND3 gene amplimer, design and amplification method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] 1. Design and synthesis of primers for amplification of mitochondrial COⅢ and ND3 genes of gobies:

[0029] Log in to the GenBank database on the NCBI website to search for the COⅢ gene and tRNA-Arg gene sequences of the mitochondrial genomes of other species of gobies and related species that have been determined, load the sequences into the analysis software MEGA5.0, and use the ClustalW algorithm to perform Multi-sequence alignment analysis, find the conserved sequence, load the found conserved sequence into Premier Primer5.0 software and design a goby in the manual design mode (that is, select Low under the manual option, and the specific parameters are the default settings). Fish mitochondrial COⅢ and ND3 gene amplification primers: the light chain primer Gobies-COⅢ-ND3-F (shown in SEQ ID No.1) has 21 bases: ATACCACATAGTAGACCCCAG, located on the COⅢ gene; the heavy chain primer Gobies-COⅢ -ND3-R (shown in SEQ ID No.2) has 21 bases: GACTTTAACCACGAGCTTTTG, located on...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fish mitochondrial genome research field, and concretely relates to a COIII and ND3 gene amplimer, the gene amplimer is composed of two strips of single chain oligonucleotide chains, wherein a light chain primer is a nucleotide sequence shown in SEQ ID NO.1, and a heavy chain primer is a nucleotide sequence shown in SEQ ID NO.2. The invention also provides a design and an amplification method of the amplimer. The invention can specifically amplify a plurality of goby mitochondrion COIII and ND3 gene sequences with high efficiency, and can be used in goby different classification category systems evolution and classification research.

Description

Technical field [0001] The present invention is a field of fish mitochondrial genome research. It is specific to an efficient amplification of a variety of shrimp tiger tiger mitochondria cytoids C (CYTC) oxidase sub -Ⅲ (Cytochrome C oxidase Subunit III; CO III) sequence and NADHRestrane composite subunit 3 (NDHYDROGENASE SUBUNITS 3; ND3) A amplified primers and their design and amplification methods for the entire sequence of genes. Background technique [0002] Fish mitochondrial genome consists of 13 coding protein genes, 22 TRNA genes, 2 RRNA genes (12S RRNA and 16S RRNA), a total of 37 coding genes and a major non -encoding area (control zone).The number of matriarchal genetics, strict maternity inheritance, almost no reorganization, high coding efficiency, fast evolutionary speed, and differences in the evolution speed of different areas.Due to the characteristics of fish mitochondrial genome, it has become an important molecular label in research fields such as fish molecu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12N15/10
Inventor徐田军王日昕金逍逍孙悦娜
OwnerZHEJIANG OCEAN UNIV