Construction and Application of Recombinant Adenoviral Vector of Survivin Promoter Regulating cd Gene
A recombinant adenovirus and promoter technology, applied in the field of recombinant adenovirus, can solve the problems of normal tissue damage and ideal curative effect for tumor patients, and achieve the effect of enhancing specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Amplification of the Survivin promoter
[0040] Primers were designed according to the sequence of the survivin promoter in Genebank, and the restriction sites AseI and NheI were introduced into the primers respectively,
[0041] Upstream primer SEQNO:3:
[0042] GGCATTAATTCTAGATCCCCAGCTCCCTTGTCTTCTTAT,
[0043] Downstream primer SEQNO:4:
[0044] AATGCTAGCAGTAGAGGCGGGGCGGCGC.
[0045] Use this primer to perform PCR amplification using the genomic DNA of BEL-7402 as a template: pre-denaturation at 94°C for 5 minutes; 40s at 94°C, 50s at 55°C, 50s at 72°C, 35 cycles of amplification and extension at 72°C for 5 minutes, and the PCR product was subjected to agar agar Glycogel electrophoresis analysis, get a specific band (such as figure 1 ), the size of the fragment is about 700bp, which is in line with the expected size. After the gel recovery of the fragment, it is connected to the pGEM-T vector to construct a recombinant plasmid pT-SP. After transforming ...
Embodiment 2
[0046] Example 2: Construction and expression activity detection of green fluorescent protein (GFP) reporter plasmid regulated by survivin promoter
[0047] Digest pT-SP and pEGFP-N1 plasmids with NheI and AseI restriction endonucleases, and recover the excised survivin promoter and the pEGFP-N1 plasmid with excised CMV promoter respectively, and detect the concentration of the two by electrophoresis after recovery ( figure 2 ), and then transform E. coli after overnight ligation, pick clones for colony PCR detection, and confirm positive clones to extract plasmids for transfection.
[0048] Use Lipofectamine2000 to transfect pSP-EGFP plasmid into different cells, including human liver cancer cell line BEL-7402, human liver cancer cell line HepG2, human cervical cancer cell line HeLa and non-tumor cell line HEK-293. At the same time, pEGFP-N1 was used as a positive control, and fluorescence observation was performed 48 hours after transfection. It can be seen that the expre...
Embodiment 3
[0049] Embodiment 3: the cloning of yeast cell Cytosinedeaminase (CD) gene
[0050] Primers were designed according to the sequence of Saccharomyces cerevisiae CD gene in Genebank, and restriction sites SacI and SalI were introduced into the primers respectively,
[0051] Upstream primer SEQNO:5: atagagctcacgATGGTGACAGGGGGAATGGC,
[0052] Downstream primer SEQ NO: 6: cgcgtcgacCTACTCACCAATATCTTCAAACC.
[0053] Use this primer to carry out PCR amplification using the genomic DNA of Saccharomyces cerevisiae cells as a template: pre-denature at 94°C for 10 minutes; Glycogel electrophoresis analysis, get a specific band (such as Figure 4 ), the size of the fragment is about 500bp, which is in line with the expected size. After the fragment is recovered by glue, it is connected to the pGEM-T vector to construct a recombinant plasmid pT-CD. After transforming E. coli DH5α, positive clones are picked and sent to the company for sequencing analysis , the result is shown in SEQNO:2,...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 