Unlock instant, AI-driven research and patent intelligence for your innovation.

Construction and Application of Recombinant Adenoviral Vector of Survivin Promoter Regulating cd Gene

A recombinant adenovirus and promoter technology, applied in the field of recombinant adenovirus, can solve the problems of normal tissue damage and ideal curative effect for tumor patients, and achieve the effect of enhancing specificity

Active Publication Date: 2016-04-27
GUANGDONG PHARMA UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] However, in the absence of expression specificity, CD / 5-FC can not only kill tumor cells, but also act on normal cells, causing serious damage to normal tissues, so it is difficult to achieve ideal curative effect in tumor patients

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and Application of Recombinant Adenoviral Vector of Survivin Promoter Regulating cd Gene
  • Construction and Application of Recombinant Adenoviral Vector of Survivin Promoter Regulating cd Gene
  • Construction and Application of Recombinant Adenoviral Vector of Survivin Promoter Regulating cd Gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1: Amplification of the Survivin promoter

[0040] Primers were designed according to the sequence of the survivin promoter in Genebank, and the restriction sites AseI and NheI were introduced into the primers respectively,

[0041] Upstream primer SEQNO:3:

[0042] GGCATTAATTCTAGATCCCCAGCTCCCTTGTCTTCTTAT,

[0043] Downstream primer SEQNO:4:

[0044] AATGCTAGCAGTAGAGGCGGGGCGGCGC.

[0045] Use this primer to perform PCR amplification using the genomic DNA of BEL-7402 as a template: pre-denaturation at 94°C for 5 minutes; 40s at 94°C, 50s at 55°C, 50s at 72°C, 35 cycles of amplification and extension at 72°C for 5 minutes, and the PCR product was subjected to agar agar Glycogel electrophoresis analysis, get a specific band (such as figure 1 ), the size of the fragment is about 700bp, which is in line with the expected size. After the gel recovery of the fragment, it is connected to the pGEM-T vector to construct a recombinant plasmid pT-SP. After transforming ...

Embodiment 2

[0046] Example 2: Construction and expression activity detection of green fluorescent protein (GFP) reporter plasmid regulated by survivin promoter

[0047] Digest pT-SP and pEGFP-N1 plasmids with NheI and AseI restriction endonucleases, and recover the excised survivin promoter and the pEGFP-N1 plasmid with excised CMV promoter respectively, and detect the concentration of the two by electrophoresis after recovery ( figure 2 ), and then transform E. coli after overnight ligation, pick clones for colony PCR detection, and confirm positive clones to extract plasmids for transfection.

[0048] Use Lipofectamine2000 to transfect pSP-EGFP plasmid into different cells, including human liver cancer cell line BEL-7402, human liver cancer cell line HepG2, human cervical cancer cell line HeLa and non-tumor cell line HEK-293. At the same time, pEGFP-N1 was used as a positive control, and fluorescence observation was performed 48 hours after transfection. It can be seen that the expre...

Embodiment 3

[0049] Embodiment 3: the cloning of yeast cell Cytosinedeaminase (CD) gene

[0050] Primers were designed according to the sequence of Saccharomyces cerevisiae CD gene in Genebank, and restriction sites SacI and SalI were introduced into the primers respectively,

[0051] Upstream primer SEQNO:5: atagagctcacgATGGTGACAGGGGGAATGGC,

[0052] Downstream primer SEQ NO: 6: cgcgtcgacCTACTCACCAATATCTTCAAACC.

[0053] Use this primer to carry out PCR amplification using the genomic DNA of Saccharomyces cerevisiae cells as a template: pre-denature at 94°C for 10 minutes; Glycogel electrophoresis analysis, get a specific band (such as Figure 4 ), the size of the fragment is about 500bp, which is in line with the expected size. After the fragment is recovered by glue, it is connected to the pGEM-T vector to construct a recombinant plasmid pT-CD. After transforming E. coli DH5α, positive clones are picked and sent to the company for sequencing analysis , the result is shown in SEQNO:2,...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a recombinant adenovirus, which contains a cytosine deaminase gene (CD gene), and the CD gene is controlled by a Survivin promoter designed in the invention. It is more necessary to further disclose the preparation method of the recombinant adenovirus and apply the recombinant adenovirus to the medicine for treating cancer. The recombinant adenovirus provided by the invention has good specificity to tumor cells, and does not affect the survival of normal cells while initiating the suicide program of tumor cells.

Description

technical field [0001] The present invention relates to a recombinant adenovirus, more specifically, to the construction of a recombinant adenovirus vector in which a survivin promoter targets and regulates the suicide gene cytosine deaminase (cytosine deaminase, CD), and the recombinant adenovirus Application of viruses in anticancer therapeutic drugs. Background technique [0002] Cancer is one of the malignant diseases that seriously threaten human health, and it is also one of the major problems facing scientific research today. Traditional treatment methods are difficult to eradicate tumors and are accompanied by severe side effects. With the continuous development of life sciences, gene therapy is expected to become a new means to replace traditional tumor treatment. The key to whether gene therapy can be successfully applied in clinical practice is the targeting of the treatment, and good targeting can ensure the safety and effectiveness of the treatment. [0003] ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/55C12N15/861C12N15/66A61K48/00A61P35/00
Inventor 邵红伟黄树林沈晗吴凤麟张文峰李家明
Owner GUANGDONG PHARMA UNIV