Method for producing beta-amyrin with saccharomyces cerevisiae engineering bacterium

A technology of Saccharomyces cerevisiae and arysinol, applied in the direction of microorganism-based methods, biochemical equipment and methods, fermentation, etc., which can solve the problems of low accumulation of β- arysinol and difficult synthesis by chemical methods, and achieve easy genetic manipulation , simplification of fermentation process, and efficient effect of gene assembly process

Active Publication Date: 2014-01-15
BEIJING INSTITUTE OF TECHNOLOGYGY
View PDF0 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a method for producing β-amyresin by using Saccharomyces cerevisiae engineering bacteria to solve the limitations of low accumulation of β-amyresin in licorice and difficult synthesis by chemical methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for producing beta-amyrin with saccharomyces cerevisiae engineering bacterium
  • Method for producing beta-amyrin with saccharomyces cerevisiae engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1: Construction of Saccharomyces cerevisiae Genetic Engineering Bacteria

[0017] 1. The 2,3-oxidized squalene monooxygenase SQE gene fragment was cloned from Candida albicans CGMCC2.2086, which was consistent with the gene sequence of Candida albicans 2,3-oxidized squalene monooxygenase published by Genbank (Genbank registration sequence number AB037203) was compared by BLAST, and the homology analysis showed that the homology of the cloned SQE gene fragment and the Candida albicans 2,3-oxosqualene monooxygenase gene published in the Genbank gene bank was 100%.

[0018] The primer sequences are:

[0019] Primer 1: 5'> GATTAGCATCCATAACCGCATACTCTAATTGACGATAAC ATGAGTTCAGTTAAGTATGA<3' (as shown in SEQ ID No.1), the underlined sequence is the overlapping sequence with the promoter TYS1p.

[0020] Primer 2: 5'> GCCAAGTAGGCAATTTTTAGTACTGTCAGTATTGTTAT CTATCTTACAATCTCGTTCC<3' (as shown in SEQ ID No.2), the underlined sequence is the overlapping sequence with the...

Embodiment 2

[0049] Example 2: Verification of Saccharomyces cerevisiae Engineering Bacteria Fermentative Production of β-Arysinol

[0050] Select the Saccharomyces cerevisiae engineered bacterium screened out in Example 1, culture in shake flasks at 30°C in a medium containing 2% glucose, 2% peptone and 1% yeast powder, centrifuge at 5000rpm for 5min after 5 days, and use 10mL of 20% hydrogen for precipitation Resuspend in potassium oxide solution (containing 50% ethanol), boil in boiling water for 10 min, extract twice with n-hexane after cooling at room temperature, combine the extracts and concentrate to 1 mL, then add 100 μL pyridine and 50 μL N,O to the concentrated solution -Bis(trimethylsilyl)trifluoroacetamide, react at 37°C for 2h. Shimadzu Gas Chromatography-Mass Spectrometry GCMS-QP2010 equipped with Agilent Chromatographic Column DB-1 (30m*0.25mm*0.25um) was used to analyze the fermentation of Saccharomyces cerevisiae engineering bacteria to produce β-amyresinol. For component...

Embodiment 3

[0051] Example 3: Application of Saccharomyces cerevisiae Engineering Bacteria in the Fermentative Production of β-Arysinol

[0052] Seed liquid culture: Pick a single colony of Saccharomyces cerevisiae engineering bacteria screened in Examples 1 and 2 from the plate, inoculate in 40mL medium containing 2% glucose, 2% peptone and 1% yeast powder, 30°C, 170rpm Shake culture for 36h.

[0053] Fermentation test: transfer the inoculum solution to a 300mL shake flask containing 100mL fermentation medium (2% glucose, 2% peptone, 1% yeast powder, pH7.0) according to the inoculum size with an initial absorbance value of 0.10, at 30°C, 170rpm Shake culture for 120 hours, sample once every 24 hours, and measure the content of β-amyresinol in Saccharomyces cerevisiae cells. The results showed that the content of β-amyresinol reached 11.7 mg / L after fermentation of S. cerevisiae engineered bacteria.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for producing beta-amyrin with a saccharomyces cerevisiae engineering bacterium, and belongs to the field of biochemical engineering. According to the method, a 2,3-oxidized squalene monooxygenase gene is cloned from candida albicans, a glycyrrhiza glabra beta-amyrin synthase gene subjected to codon optimization is chemically synthesized, a gene expression cassette is constructed by utilizing a saccharomyces cerevisiae constitutive promoter, the gene expression cassette and a plasmid after double digestion jointly invert saccharomyces cerevisiae, and assembly of the gene expression cassette and the plasmid is achieved by a homologous recombination function of the saccharomyces cerevisiae, so that 2,3-oxidized squalene monooxygenase is reinforced, and beta-amyrin synthase is led in. Saccharomyces cerevisiae engineering bacterium metabolizable glucose directly synthesizes beta-amyrin, and synthesis of beta-amyrin is coupled with growth of the saccharomyces cerevisiae, so that artificial synthesis of the saccharomyces cerevisiae of a plant secondary metabolism product, namely beta-amyrin is achieved. The method requires no effect agent induction, is simple in technology, and can be used for fermenting and producing beta-amyrin.

Description

technical field [0001] The invention relates to a construction of Saccharomyces cerevisiae engineering bacteria and a method for fermenting and producing β-amyresinol, which belongs to the field of biochemical industry. Background technique [0002] Terpenoids are a class of plant secondary metabolites with special value. They have important functions in resisting biotic and abiotic stresses such as infection, ultraviolet radiation, and drought. Many terpenes have shown pharmaceutical activity against human diseases. Glycyrrhizic acid is the most important terpenoid compound of the traditional Chinese medicinal plant licorice, which has many functions such as anti-infection, anti-inflammation, anti-ulcer, anti-virus and prevention and treatment of tumors. β-Arysinol is an important precursor for the biosynthesis of glycyrrhizic acid. It not only has similar biological functions as glycyrrhizic acid, but also has special effects in antihypertensive and hypolipidemic aspects. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/19C12N15/63C12P33/00C12R1/865
Inventor李春张根林周晓宏刘静竹
OwnerBEIJING INSTITUTE OF TECHNOLOGYGY