Unlock instant, AI-driven research and patent intelligence for your innovation.

Shrna lentiviral expression vector for specifically inhibiting human sirt1 gene expression and its construction method and application

An expression vector, gene expression technology, applied in the field of genetic engineering

Inactive Publication Date: 2016-06-22
FOURTH MILITARY MEDICAL UNIVERSITY
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] However, there is no shRNA expression vector with high transfection efficiency and long-term stable expression that specifically inhibits the expression of human SIRT1 gene in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Shrna lentiviral expression vector for specifically inhibiting human sirt1 gene expression and its construction method and application
  • Shrna lentiviral expression vector for specifically inhibiting human sirt1 gene expression and its construction method and application
  • Shrna lentiviral expression vector for specifically inhibiting human sirt1 gene expression and its construction method and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Embodiment 1: the design of the shRNA oligonucleotide sequence of human SIRT1 gene

[0036] The complete mRNA sequence of SIRT1 (NM_012238.4|) was found in GenBank, and the specificity was confirmed by BLAST homology comparison. Then, the RNAstructure4.4 software was used to evaluate the sequence of the target mRNA to obtain 4 target nucleotide sequences, as shown in Table 1. ,

[0037] serial number

target nucleotide sequence

target location

Article 1

No1: GCAACTATACCCAGAACATAG

1075-1095

Article 2

No4: GCTGATGAACCGCTTGCTATC

1251-1271

Article 3

No7: GCTTGATGGTAATCAGTATCT

1961-1981

Article 4

No10: GGAGATGATCAAGAGGCAATT

2214-2234

[0038]According to the target nucleotide sequence, the DNA template single strands of two shRNAs are designed and synthesized. AAAG and AAAA are added to the 5' ends of the sense and antisense strands respectively, which are complementary to the cohesive ends form...

Embodiment 2

[0041] Example 2: Construction of shRNA lentiviral expression vector of human SIRT1 gene

[0042] 1. Annealing of shDNA template

[0043] Components

Volume (ul)

10XshDNA Annealing Buffer

5

sense strand (100 uM)

5

antisense strand (100 uM)

5

wxya 2 o

35

Total

50

[0044] Perform annealing treatment on the PCR instrument according to the following procedures: 95oC5min; 85oC5min; 75oC5min; 70oC5min; 4oC storage. After annealing treatment, the shRNA template with a concentration of 10 μM was obtained. The resulting template solution was diluted 50-fold to a final concentration of 200 nM for the ligation reaction.

[0045] Connect with the carrier

[0046] After annealing, the shRNA was ligated into the lentiviral siRNA vector pFIV-H1 / U6-copGFP (SystemBiosciences) (see pFIV-H1 / U6-copGFP vector map image 3 ), the basic sequence of the pFIV-H1 / U6-copGFP vector belongs to common knowledge and will not be de...

Embodiment 3

[0081] Example 3: shRNA lentiviral packaging of human SIRT1 gene

[0082] 293FT cells were cultured, and the cells in good growth state were inoculated into 6-well culture plates, 10 per well 6 cells, using Lipofectamine TM In 2000, 2 mg each of the extracted recombinant plasmids pFIV-shRNA1, pFIV-shRNA2, pFIV-shRNA3, pFIV-shRNA4, and negative control plasmids and lentiviral packaging plasmid pPACKH1? PackagingPlasmidmix 1 mg were transferred to 293FT cells, and the supernatant containing the virus was collected for 48 hours and cultured base, filter the virus liquid with a 0.45mm filter, and use it to transduce human scar fibroblasts.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention provides a shRNA lentiviral expression vector that specifically inhibits the expression of human SIRT1 gene and its construction method and application. The expression vector is obtained by evaluating the target mRNA sequence based on the full sequence of human SIRT1 mRNA by using RNA structure 4.4 software 4 target nucleotide sequences, after introducing corresponding adapters at both ends of the 4 target nucleotide sequences, the corresponding shRNA oligonucleotide sequences are obtained, and the shRNA oligonucleotide sequences are inserted into the polyclonal site, linked to the lentiviral siRNA vector pFIV-H1 / U6-copGFP. The multiple cloning site includes a Bbs I restriction site, and AAAG and AAAA are added to the 5' ends of the sense and antisense strands respectively, which are complementary to the cohesive ends formed after Bbs I restriction; the human SIRT1 gene provided by the invention The expressed shRNA lentiviral expression vector has high transfection efficiency, can sustainably, stably and specifically inhibit the expression of human SIRT1 gene, and can be used for scientific research and preparation of drugs for treating diseases related to abnormal expression of human SIRT1 gene.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, and in particular relates to an shRNA lentiviral expression vector for specifically inhibiting human SIRT1 gene expression, a construction method and application thereof. Background technique [0002] Silent information regulator 1 (silent information regulatorl, SIRT1) is NAD ＋ Dependent protein deacetylase, belonging to the Sirtuin family, can be expressed in mammals and mainly expressed in the nucleus. It was originally defined as a family of NAD-dependent sirtuin enzymes, which can deacetylate lysine residues in various proteins ; It is a kind of evolutionarily highly conserved protein, which is involved in the occurrence of various biological events in cells, because the function of SIRT1 depends on NAD + , its role is related to the body's reaction to oxidation and metabolism. Studies have found that SIRT1 plays an important role in DNA damage repair, cell cycle control, inhib...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867A61K48/00A61P17/02
Inventor 白晓智胡大海陶克韩军涛朱雄翔董茂龙苏琳琳石继红汤朝武
Owner FOURTH MILITARY MEDICAL UNIVERSITY