Method for screening for compound capable of enhancing or inhibiting OATP1B1 transport activity, and method for determining expression level of OATP1B1
A technology of expression level and forced expression, which is applied in the screening of compounds, biochemical equipment and methods, and the determination/inspection of microorganisms. It can solve the problems of not necessarily high detection sensitivity, low fluorescence intensity, and few fluorescent compounds. Inexpensive, easy-to-operate effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
( example 1
[0056] (Example 1: Study on the substrate specificity of various fluorescein derivatives)
[0057] Various fluorescent dyes, ie, the following fluorescein derivatives, were investigated individually for their suitability as OATP substrates.
[0058] [chemical formula 1]
[0059]
[0060] [Table 1]
[0061]
[0062] Complementary DNA of OATP1B1, OATP1B3, and OATP2B1 (shown by SEQ ID NOs: 2, 3, and 4, respectively) was performed by RT-PCR using human liver total RNA (Invitrogen Corporation) as a template and using the following primers To clone:
[0063] Primers for OATP1B1
[0064] Sense primer: CGTCCGACTTGTTGCAGTTG (SEQ ID NO: 5)
[0065] Antisense primer: AACACAGAAGCAGAAGTGGC (SEQ ID NO: 6)
[0066] Primers for OATP1B3
[0067] Sense primer: TAACATCAGAAAAAGGATGGACTTG (SEQ ID NO: 7)
[0068]Antisense primer: TGCAATGTTAGTTGGCAGCA (SEQ ID NO: 8)
[0069] Primers for OATP2B1
[0070] Sense primer: CTGAGAAGATTTGCTTCCTC (SEQ ID NO: 9)
[0071] Antisense primer: ACT...
( example 2
[0076] (Example 2: Time profile of DCF uptake via OATP1B1)
[0077] As described in Example 1, HEK-293 cells expressing OATP1B1 were prepared and 4×10 5 cells / well were seeded on poly-D-lysine-coated dishes. The medium was replaced with KH buffer, and DCF dissolved in DMSO was added to the cells so that the final concentration in KH buffer was 0.1 μM, 1 μM, and 10 μM, followed by incubation at 37° C. for 0 to 30 minute. The cells were sampled at incubation times of 1 min, 5 min, 10 min, and 30 min, washed three times with ice-cold KH buffer, and then solubilized with 0.1 N aqueous NaOH, then measured as described in Example 1 for the uptake by the cells. The fluorescence intensity of the fluorescent dye (excitation wavelength: 490nm, fluorescence wavelength: 515nm).
[0078] The results are shown in figure 2 middle. figure 2 It was revealed that the amount of DCF taken up by HEK-293 cells enhanced to express OATP1B1 into these cells increased over time and depended on t...
( example 3
[0079] (Example 3: Kinetic analysis of DCF uptake via OATP1B1)
[0080] As described in Example 1, HEK-293 cells expressing OATP1B1 were prepared and 4×10 5 cells / well were seeded on poly-D-lysine-coated dishes. The medium was replaced with KH buffer, and DCF dissolved in DMSO was added to the cells so that the final concentration in the KH buffer was 0.1 to 100 μM, followed by incubation at 37° C. for 5 minutes. Absorption rates at DCF concentrations of 0.1 μM, 0.3 μM, 1 μM, 3 μM, 10 μM, 30 μM, and 100 μM were plotted and analyzed by Michaelis-Menten curves.
[0081] The results are shown in image 3 middle. Calculation of K by the following Michaelis-Menten equation m and V max . As a result, V max is 131.6 (pmol / min / mg protein), and K m is 7.22 (μM). Each parameter represents the mean of four independent experiments. DCF was revealed to be a satisfactory substrate for OATP1B1.
[0082] v=V max · S / (K m +S)
PUM
Property | Measurement | Unit |
---|---|---|
wavelength | aaaaa | aaaaa |
fluorescence wavelength | aaaaa | aaaaa |
composition ratio | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com