Supercharge Your Innovation With Domain-Expert AI Agents!

Method for screening for compound capable of enhancing or inhibiting OATP1B1 transport activity, and method for determining expression level of OATP1B1

A technology of expression level and forced expression, which is applied in the screening of compounds, biochemical equipment and methods, and the determination/inspection of microorganisms. It can solve the problems of not necessarily high detection sensitivity, low fluorescence intensity, and few fluorescent compounds. Inexpensive, easy-to-operate effects

Active Publication Date: 2014-02-19
EISIA R&D MANAGEMENT CO LTD
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In general, however, it is difficult to predict whether a compound will act as a substrate for a transporter, and, therefore, not many fluorescent compounds are known to act as substrates for anion transporters
In addition, some conventional fluorescent substrates have various disadvantages, such as the detection sensitivity is not necessarily high due to the low fluorescence intensity emitted by the substrate itself, the autofluorescence of the test compound, and the photobleaching of the fluorescent substrate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening for compound capable of enhancing or inhibiting OATP1B1 transport activity, and method for determining expression level of OATP1B1
  • Method for screening for compound capable of enhancing or inhibiting OATP1B1 transport activity, and method for determining expression level of OATP1B1
  • Method for screening for compound capable of enhancing or inhibiting OATP1B1 transport activity, and method for determining expression level of OATP1B1

Examples

Experimental program
Comparison scheme
Effect test

( example 1

[0056] (Example 1: Study on the substrate specificity of various fluorescein derivatives)

[0057] Various fluorescent dyes, ie, the following fluorescein derivatives, were investigated individually for their suitability as OATP substrates.

[0058] [chemical formula 1]

[0059]

[0060] [Table 1]

[0061]

[0062] Complementary DNA of OATP1B1, OATP1B3, and OATP2B1 (shown by SEQ ID NOs: 2, 3, and 4, respectively) was performed by RT-PCR using human liver total RNA (Invitrogen Corporation) as a template and using the following primers To clone:

[0063] Primers for OATP1B1

[0064] Sense primer: CGTCCGACTTGTTGCAGTTG (SEQ ID NO: 5)

[0065] Antisense primer: AACACAGAAGCAGAAGTGGC (SEQ ID NO: 6)

[0066] Primers for OATP1B3

[0067] Sense primer: TAACATCAGAAAAAGGATGGACTTG (SEQ ID NO: 7)

[0068]Antisense primer: TGCAATGTTAGTTGGCAGCA (SEQ ID NO: 8)

[0069] Primers for OATP2B1

[0070] Sense primer: CTGAGAAGATTTGCTTCCTC (SEQ ID NO: 9)

[0071] Antisense primer: ACT...

( example 2

[0076] (Example 2: Time profile of DCF uptake via OATP1B1)

[0077] As described in Example 1, HEK-293 cells expressing OATP1B1 were prepared and 4×10 5 cells / well were seeded on poly-D-lysine-coated dishes. The medium was replaced with KH buffer, and DCF dissolved in DMSO was added to the cells so that the final concentration in KH buffer was 0.1 μM, 1 μM, and 10 μM, followed by incubation at 37° C. for 0 to 30 minute. The cells were sampled at incubation times of 1 min, 5 min, 10 min, and 30 min, washed three times with ice-cold KH buffer, and then solubilized with 0.1 N aqueous NaOH, then measured as described in Example 1 for the uptake by the cells. The fluorescence intensity of the fluorescent dye (excitation wavelength: 490nm, fluorescence wavelength: 515nm).

[0078] The results are shown in figure 2 middle. figure 2 It was revealed that the amount of DCF taken up by HEK-293 cells enhanced to express OATP1B1 into these cells increased over time and depended on t...

( example 3

[0079] (Example 3: Kinetic analysis of DCF uptake via OATP1B1)

[0080] As described in Example 1, HEK-293 cells expressing OATP1B1 were prepared and 4×10 5 cells / well were seeded on poly-D-lysine-coated dishes. The medium was replaced with KH buffer, and DCF dissolved in DMSO was added to the cells so that the final concentration in the KH buffer was 0.1 to 100 μM, followed by incubation at 37° C. for 5 minutes. Absorption rates at DCF concentrations of 0.1 μM, 0.3 μM, 1 μM, 3 μM, 10 μM, 30 μM, and 100 μM were plotted and analyzed by Michaelis-Menten curves.

[0081] The results are shown in image 3 middle. Calculation of K by the following Michaelis-Menten equation m and V max . As a result, V max is 131.6 (pmol / min / mg protein), and K m is 7.22 (μM). Each parameter represents the mean of four independent experiments. DCF was revealed to be a satisfactory substrate for OATP1B1.

[0082] v=V max · S / (K m +S)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
fluorescence wavelengthaaaaaaaaaa
composition ratioaaaaaaaaaa
Login to View More

Abstract

The present invention provides a method of screening for a compound that enhances or inhibits the transport activity of OATP1B1, using dichlorofluorescein. The present invention also provides a use of dichlorofluorescein in measurement of the expression level of OATP1B1. The present invention further provides a method for measuring the expression level of OATP1B1 in test cells, using dichlorofluorescein. The present invention further provides a use of a kit including dichlorofluorescein and positive cells expressing OATP1B1 in measurement of the expression level of OATP1B1 in test cells.

Description

technical field [0001] The present invention relates to a method for screening compounds that enhance or inhibit OATP1B1 transport activity using a fluorescent compound dichlorofluorescein, and relates to a method for measuring the expression level of OATP1B1. Background technique [0002] In recent years, hepatocytes have been increasingly recognized to play an important role in drug discovery. Hepatocytes are an essential tool for pharmacokinetic studies of drugs, such as the prediction of drug clearance in vivo or the study of drug interactions. The molecular mechanisms of various metabolic enzymes and transporters that are expressed in hepatocytes and play a dominant role in the pharmacokinetics (absorption, distribution, metabolism, and excretion) of drugs have been revealed. Among them, most attention has been focused on the role of organic anion-transporting polypeptides (OATPs) in the pharmacokinetics of anionic drugs (Non-Patent Document 1). [0003] OATP family t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/02C12N15/09
CPCG01N21/6486G01N33/5067G01N33/6872G01N2500/00G01N33/5008G01N33/582C09B11/24
Inventor 和泉沙希小森高文野崎芳胤
Owner EISIA R&D MANAGEMENT CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More