The miRNA molecules that negatively regulate the type I interferon pathway and their applications
A technology of interferon and type I, applied in the field of molecular biology, can solve the problem of little research work on miRNA function
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Example 1, Hsa-miR-127-3p can significantly inhibit TypeIIFN-induced ISRE / GAS-luciferase (luciferase) activity
[0077] The inventor co-transfected ISRE or GAS reporter gene carrier and Hsa-miR-127-3pmimics or negative control (NC) mimics in Hela cells, and after TypeIIFN stimulation for 6hr, the luciferase activity was detected with a dual-luciferase reporter gene assay system , found that Hsa-miR-127-3p can inhibit TypeIIFN-induced ISRE-Luciferase (luciferase) activity ( figure 1 A) or GAS-Luciferase (luciferase) activity ( figure 1 B).
[0078] This result indicated that Hsa-miR-127-3p could inhibit the TypeIIFN pathway.
[0079] The function of microRNA mainly depends on the sequence of its seed region, so the inventors designed the mutants seedmut1 and seedmut2 of hsa-miR-127-3p seed region sequence. The sequence is as follows (the underline indicates the modified base):
[0080] hsa-miR-127-3pseedmut1 (SEQ ID NO: 10):
[0081] 5'UCGGAUCCGUCUGAGCUUGGCU3' (SEQ ...
Embodiment 2
[0088] Example 2, Hsa-miR-127-3p can significantly inhibit the expression of downstream genes induced by TypeIIFN
[0089] In order to further verify the function of Hsa-miR-127-3p in the TypeIIFN pathway, the inventors transferred Hsa-miR-127-3pmimics into Hela cells, and after TypeIIFN stimulation for 6 hours, the downstream gene expression induced by TypeIIFN was detected, compared with the control In contrast, Hsa-miR-127-3pmimics can significantly inhibit TypeIIFN-induced expression of downstream genes such as CCL2, CXCL10 and IFIT3 ( figure 2 A).
[0090] After stimulation, the protein expression levels of CCL2 and CXCL10 in the supernatant were detected. The results showed that Hsa-miR-127-3p could significantly inhibit the expression of CCL2 and CXCL10 ( figure 2 B). This shows that Hsa-miR-127-3p can indeed negatively regulate the expression of genes downstream of the TypeIIFN pathway.
Embodiment 3
[0091] Example 3, Hsa-miR-127-3p participates in the negative regulation of the TypeIIFN pathway by inhibiting the phosphorylation of STAT1 and STAT2
[0092] It has been reported that in the TypeIIFN pathway, after TypeIIFN binds to its receptor, it activates downstream phosphokinases, further phosphorylates STAT1 and STAT2, and activates them. Phosphorylated STAT1 and STAT2 enter the nucleus and activate TypeIIFN-induced genes. Expression [Platanias, L.C. Mechanisms of type-I-andtype-II-interferon-mediated signaling. Nature Reviews Immunology. 2005.5(5):375-386]. Phosphorylated STAT1 and STAT2 play an important role in the activation of the entire TypeIIFN pathway, so the inventors doubt whether Hsa-miR-127-3p can participate in regulating the TypeIIFN pathway by affecting the phosphorylation of STAT1 and STAT2. The inventors transferred Hsa-miR-127-3pmimics into Hela cells, and after TypeIIFN stimulation for 6 hours, the inventors found by Western Blot that compared with th...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More