Nematode apoptosis regulatory gene ced-4 inducible promoter, rice expression vector and preparation method thereof

A technology for expressing vectors and regulating genes, which is applied in the direction of using vectors to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems that expression vectors have not been reported yet

Active Publication Date: 2014-06-25
YICHUN UNIVERSITY
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The inducible promoter W-box has been studied in dicotyledonous plants such as tobacco and successfully induced expression in pathogen infection, but it has not been reported to induce the expression vector of the target gene ced-4 in rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Nematode apoptosis regulatory gene ced-4 inducible promoter, rice expression vector and preparation method thereof
  • Nematode apoptosis regulatory gene ced-4 inducible promoter, rice expression vector and preparation method thereof
  • Nematode apoptosis regulatory gene ced-4 inducible promoter, rice expression vector and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The wn-2 promoter sequence is as SEQ ID NO.1;

[0035] The promoter wn-2 and P35S (SEQ ID NO.7) were cloned into the pCAMBIA1305.1 vector (wn-2 is located in front of P35S) to obtain the intermediate vector pCA-Wn-2, and the primers for amplifying the Wn-2-P35S fusion product as follows:

[0036] Wn-2-P35S-FP:

[0037] AAAGAATTC-TTCTAGCCACCAGATTTGACCAAACCATCAACTCATCTGTATATAATAT GGAGTCAAAGATTCAAATAGAGGACC (SEQ ID NO. 3);

[0038] Wn-2-P35S-RP:

[0039] AAAACTAGTCTGCAGAGTCCCCCGTGTTTCTCTCCA (SEQ ID NO. 4);

[0040] The specific process is: Insert EcoRI and SpeI (before the p35S promoter and the front part of GUS) into the pCAMBIA1305.1 vector through the EcoRI and SpeI sites to obtain the intermediate vector pCA-Wn-2;

[0041] Cloning the target gene ced-4 into the pCA-Wn-2 vector (through the PstI and PmlI sites) to obtain the rice expression vector, named pCA-wn-2-CED-4 expression vector, pCA-wn-2 -The CED-4 expression vector sequence is shown in SEQ ID NO.2;

[00...

Embodiment 2

[0047] Verification of embodiment 2 rice expression vector

[0048] The rice expression vector constructed, through experimenting with various treatments, experimental design and induction experimental steps and results are as follows:

[0049] (1) Transgenic rice seedlings were inoculated with rice root nematodes.

[0050] (2) Detect rice root epidermal cell apoptosis and allergic reaction phenotype, see the statistical table of staining test results.

[0051] (3) Detection of the protein CED-4 expressed by the transgenic target gene, see the accompanying drawings.

[0052] Staining method for measuring allergic reaction of rice root cells:

[0053] After the rice roots were dyed for 15 minutes, they were fully washed with running water to remove the unbound dye, and the dye bound to the dead cells was extracted with 20 mL of a solution containing 50% methanol and 1% SDS at 50°C for 30 minutes, and the light absorption value of the extract was measured. The measurement wav...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a nematode apoptosis regulatory gene ced-4 inducible promoter wn-2, a rice expression vector pCA-Wn-2-CED-4 and a preparation method of the pCA-Wn-2-CED-4 expression vector. According to the invention, a TATA-box core sequence shared by animal and plant genes is added into the reported core sequence having the best inductive effect in a W-box series of the promoter, therefore, a novel wn-2 sequence of a nematode apoptosis gene in rice expression is innovatively designed; the wn-2 and the inherent promoter of the rice expression vector are fused, so that the novel pCA-Wn-2-CED-4 expression vector of the rice expression vector is constructed; the pCA-Wn-2-CED-4 expression vector has the superior effect of inducing rice expression of the target gene ced-4; and the pCA-Wn-2-CED-4 expression vector is screened and connected to correct vector clone and successfully converted into rice varieties, such as Nipponbare and Lijiang Xintuan dark rice.

Description

technical field [0001] The application belongs to the field of biotechnology, and in particular relates to a nematode apoptosis regulation gene ced-4 inducible promoter, a rice expression vector and a preparation method thereof. Background technique [0002] Since the nematode cell apoptosis regulatory gene ced-4 does not exist in rice, whether the ced-4 gene can be successfully activated in rice and successfully expresses the target protein is crucial to the scientific design of the promoter; For expression in the body, it is necessary to solve the compatibility problem of the promoter between nematodes and rice, and it is also necessary to induce and initiate gene expression by pathogen infection, which is the technical goal of this patent. [0003] According to the latest relevant research literature at home and abroad, there are no detailed reports on the promoter and its expression vector induced by pathogen infection in monocotyledonous rice. [0004] The inducible pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/66
Inventor 邹一平韩成云
Owner YICHUN UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap