Nematode apoptosis regulatory gene ced-4 inducible promoter, rice expression vector and preparation method thereof
A technology for expressing vectors and regulating genes, which is applied in the direction of using vectors to introduce foreign genetic material, DNA/RNA fragments, recombinant DNA technology, etc., and can solve the problems that expression vectors have not been reported yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The wn-2 promoter sequence is as SEQ ID NO.1;
[0035] The promoter wn-2 and P35S (SEQ ID NO.7) were cloned into the pCAMBIA1305.1 vector (wn-2 is located in front of P35S) to obtain the intermediate vector pCA-Wn-2, and the primers for amplifying the Wn-2-P35S fusion product as follows:
[0036] Wn-2-P35S-FP:
[0037] AAAGAATTC-TTCTAGCCACCAGATTTGACCAAACCATCAACTCATCTGTATATAATAT GGAGTCAAAGATTCAAATAGAGGACC (SEQ ID NO. 3);
[0038] Wn-2-P35S-RP:
[0039] AAAACTAGTCTGCAGAGTCCCCCGTGTTTCTCTCCA (SEQ ID NO. 4);
[0040] The specific process is: Insert EcoRI and SpeI (before the p35S promoter and the front part of GUS) into the pCAMBIA1305.1 vector through the EcoRI and SpeI sites to obtain the intermediate vector pCA-Wn-2;
[0041] Cloning the target gene ced-4 into the pCA-Wn-2 vector (through the PstI and PmlI sites) to obtain the rice expression vector, named pCA-wn-2-CED-4 expression vector, pCA-wn-2 -The CED-4 expression vector sequence is shown in SEQ ID NO.2;
[00...
Embodiment 2
[0047] Verification of embodiment 2 rice expression vector
[0048] The rice expression vector constructed, through experimenting with various treatments, experimental design and induction experimental steps and results are as follows:
[0049] (1) Transgenic rice seedlings were inoculated with rice root nematodes.
[0050] (2) Detect rice root epidermal cell apoptosis and allergic reaction phenotype, see the statistical table of staining test results.
[0051] (3) Detection of the protein CED-4 expressed by the transgenic target gene, see the accompanying drawings.
[0052] Staining method for measuring allergic reaction of rice root cells:
[0053] After the rice roots were dyed for 15 minutes, they were fully washed with running water to remove the unbound dye, and the dye bound to the dead cells was extracted with 20 mL of a solution containing 50% methanol and 1% SDS at 50°C for 30 minutes, and the light absorption value of the extract was measured. The measurement wav...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
