Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant

A technology of transgenic plants and detection kits, which is applied in the field of molecular biology, can solve the problems such as the detection methods and kits for cry3A gene in transgenic plants, etc., and achieves the effects of simple operation, high sensitivity and strong specificity.

Inactive Publication Date: 2014-07-16
JILIN ACAD OF AGRI SCI
View PDF2 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no LAMP method has been used to detect transgenic plants. cry3A Gene detection methods and kits

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant
  • LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant
  • LAMP detecting primer group, kit and detecting method for cry3A gene in transgenic plant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Kit without chromogen and detection method thereof:

[0045] Prepared according to the following recipe cry3A Gene LAMP Detection Kit:

[0046] (1) Detection primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, and inner primer 2, make primer dry powder into mother solutions with a concentration of 100 μmol / L with sterilized deionized water, and then take 7.5 μL outer primer Primer 1, 7.5 μL outer primer 2, 60 μL inner primer 1, 60 μL inner primer 2, 15 μL sterilized deionized water, mix thoroughly to make 150 μL cry3A Gene LAMP detection primer solution, wherein the primer sequences are:

[0047] Outer primer 1: AAGCCCCACCTGTTCGA (SEQ ID NO: 1);

[0048] Outer primer 2: GGCTCGCTGCTCTTGTTG (SEQ ID NO: 2);

[0049] Internal primer 1: AGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC (SEQ ID NO: 3);

[0050] Inner primer 2: GGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA (SEQ ID NO: 4);

[0051] (2) Loop primer solution: To synthesize loop primers, p...

Embodiment 2

[0065] Example 2 Kit containing chromogen and detection method thereof

[0066] Prepared according to the following recipe cry3A Gene LAMP Detection Kit:

[0067] (1) Detection primer solution: Synthesize outer primer 1, outer primer 2, inner primer 1, and inner primer 2, make primer dry powder into mother solutions with a concentration of 100 μmol / L with sterilized deionized water, and then take 7.5 μL outer primer Primer 1, 7.5 μL outer primer 2, 60 μL inner primer 1, 60 μL inner primer 2, 15 μL sterilized deionized water, mix thoroughly to make 150 μL cry3A Gene LAMP detection primer solution, wherein the primer sequences are:

[0068] Outer primer 1: AAGCCCCACCTGTTCGA (SEQ ID NO: 1);

[0069] Outer primer 2: GGCTCGCTGCTCTTGTTG (SEQ ID NO: 2);

[0070] Internal primer 1: AGTTGAAGCTGTCGTTGCCGTACCTGCACCGCATCCAGTTC (SEQ ID NO: 3);

[0071] Inner primer 2: GGAGCGGCAACTACGTGAGCAGAAGGGGCTGGTGATGA (SEQ ID NO: 4);

[0072] (2) Loop primer solution: To synthesize loop primers,...

Embodiment 3

[0087] Embodiment 3 Specificity experiment of kit and detection method

[0088] Experiments were carried out on the specificity of the kit described in Example 2 and its detection method, and the test samples included: transgenic corn MIR604 ( cry3A ), MON89034 ( cry1A.105 , cry2Ab ), MON810 ( cry1Ab ), Bt11 ( cry1Ab ), Bt176 ( cry1Ab ), MON863 ( cry3Bb ), MON88017 ( cry3Bb ), TC1507 ( cry1F ), 59122 ( cry34Ab , cry35Ab ), transgenic cotton MON531 ( cry1Ac ), MON15985 ( cry1Ac , cry2Ab ), transgenic rice KF-6 ( cry1Ab ), TT51-1 ( cry1Ab / Ac ) and other 13 insect-resistant transgenic crops, as well as non-transgenic corn.

[0089] In this example, only the cry3A The transgenic corn MIR604 sample reaction tube of gene appears green, shows that kit of the present invention and detection method are right to cry3A Genes are very specific.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an LAMP detecting primer group, a kit and a detecting method for a cry3A gene in transgenic plant. The primer group consists of 5 specific primers with nucleotide sequences as shown in SEQ ID NO:1-5. The detecting kit comprises detecting primer liquor, loop primer liquor, DNA polymerase with strand displacement activity, 10*reaction buffer liquor, dNTPs liquor, positive DNA contrast and negative DNA contrast. The kit further contains a color developing agent. The detecting method adopts the specific primers and the DNA polymerase with the strand displacement activity to carry out amplification onto a sample DNA template at 63 DEG C-65 DEG C, and adopts a method of adding the color developing agent to observe color changes or to directly observe turbidity change of precipitates in a reaction tube, and the like, to judge whether the sample contains the cry3A gene component or not. The LAMP detecting primer group, kit and detecting method disclosed by the invention do not need a special apparatus, have the characteristics of being quick and efficient, simple and convenient to operate, strong in specificity, high in sensitivity, and the like, and are suitable for site detection.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to a method for detecting transgenic plants and their products, in particular to a rapid detection method for transgenic plants using loop-mediated isothermal amplification technology (LAMP). cry3A Primer sets, kits and assays for genes. Background technique [0002] In 2013, the global planting area of ​​genetically modified crops reached 175.2 million hectares, an increase of more than 100 times compared with the initial commercialization in 1996. At present, commercially grown transgenic crops mainly include soybean, corn, cotton, and rapeseed, and the main traits are resistance to insects and herbicides. The target genes used in insect-resistant transgenic plants are cry1Ab , cry1Ac , cry1A.105 , cry1F, cry2Ab , cry3A , cry3Bb, vip3A, cry9C etc. among them cry3A The gene exists in the genetically modified corn MIR604, which has been approved to be commercial...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6844C12Q2531/119
Inventor 李飞武闫伟李葱葱龙丽坤董立明邢珍娟夏蔚邵改革
Owner JILIN ACAD OF AGRI SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More