A method for creating brown hull rice materials by targeted editing of the glume color-determining gene oschi
A rice and gene technology, applied in the field of rice biotechnology breeding
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] The test methods used in the following examples are conventional methods unless otherwise specified.
[0034] The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified. The following examples facilitate a better understanding of the present invention, but do not limit the present invention.
[0035] Preparation of recombinant vector for rice OsCHI gene targeting .
[0036] 1.1, select the nucleotide sequence CGGCGTCGTGTTCCCGCCGG from the 30th to 52nd positions after the translation initiation codon ATG in the rice OsCHI gene (LOC_Os03g60509.1) TGG , (the underlined part is the 5'-(N) X -NGG part in the NGG-3' structure), as the targeting site.
[0037] 1.2. Synthesize (BGI Corporation) forward oligonucleotide chain (OsCHIKO1P1) and complementary reverse oligonucleotide chain (OsCHIKO1P2) according to the selected target site,
[0038] The specific sequence is:
[0039] OsCHIKO1P1: TGTG CGGCGTCG...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
