Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A method for creating brown hull rice materials by targeted editing of the glume color-determining gene oschi

A rice and gene technology, applied in the field of rice biotechnology breeding

Inactive Publication Date: 2016-07-06
RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far, no research institution has made a breakthrough in this area.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for creating brown hull rice materials by targeted editing of the glume color-determining gene oschi
  • A method for creating brown hull rice materials by targeted editing of the glume color-determining gene oschi

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0033] The test methods used in the following examples are conventional methods unless otherwise specified.

[0034] The materials and reagents used in the following examples can be obtained from commercial sources unless otherwise specified. The following examples facilitate a better understanding of the present invention, but do not limit the present invention.

[0035] Preparation of recombinant vector for rice OsCHI gene targeting .

[0036] 1.1, select the nucleotide sequence CGGCGTCGTGTTCCCGCCGG from the 30th to 52nd positions after the translation initiation codon ATG in the rice OsCHI gene (LOC_Os03g60509.1) TGG , (the underlined part is the 5'-(N) X -NGG part in the NGG-3' structure), as the targeting site.

[0037] 1.2. Synthesize (BGI Corporation) forward oligonucleotide chain (OsCHIKO1P1) and complementary reverse oligonucleotide chain (OsCHIKO1P2) according to the selected target site,

[0038] The specific sequence is:

[0039] OsCHIKO1P1: TGTG CGGCGTCG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for directional editing of the color-determining gene OsCHI to create brown hull rice materials, comprising the following steps: selecting a target segment in the exon region of the glume color-determining gene OsCHI and constructing a plant CRISPR / Cas9 targeting recombinant vector, and recombining the The vector is introduced into rice cells and regenerated into seedlings, and the rice cells are sheared under the action of the expression cassette in the vector, triggering the self-repair function of rice cell DNA. Then, through the sequencing of the target fragment of the genome of the regenerated line, a line carrying two allelic OsCHI genes with a simultaneous loss of function mutation was obtained, and after identification of the glume color, it was the brown husk rice material created. Experiments show that this method can quickly create brown-husk rice materials by using the glume color-determining gene OsCHI.

Description

technical field [0001] The invention relates to the field of rice biotechnology breeding, in particular to a breeding method for directional editing of the glume color-determining gene OsCHI to create brown-husk rice materials. Background technique [0002] Rice glume color is a marker that can be recognized after rice heading. Studies have shown that glume color is affected by many factors, including environmental factors, lignin synthesis, and accumulation and deposition of flavonoid pigments. Among them, glume The accumulation of flavonoid pigments in the medium is the main cause of various glume colors. The color of rice hulls is less affected by environmental factors, and its traits are relatively stable. It is an important marker shape for rice classification, breeding and variety differentiation. [0003] There has been a long history of genetic research on glume color both at home and abroad. The inheritance of glume color in rice is either controlled by a single g...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/82A01H5/00
Inventor 杨亚春杨剑波魏鹏程李浩倪大虎倪金龙宋丰顺陆徐忠李莉马卉
Owner RICE RES ISTITUTE ANHUI ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com