Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of preparation method of veterinary follicle stimulating hormone analogue

A follicle-stimulating hormone and analogue technology, applied in the field of genetic engineering, can solve problems such as not fully considering the influence of connection sequences, and achieve significant commercial value, increased expression, and good substitution effects

Inactive Publication Date: 2017-02-15
林静静 +1
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This invention emphasizes the effect of glycosylation on long-acting effects, but does not fully consider the influence of the connecting sequence itself on the expression of the fusion protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of preparation method of veterinary follicle stimulating hormone analogue
  • A kind of preparation method of veterinary follicle stimulating hormone analogue
  • A kind of preparation method of veterinary follicle stimulating hormone analogue

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Construction of expression plasmids and establishment of engineered cells

[0025] 1. According to the amino acid sequence and nucleotide sequence of natural sheep FSH recorded on Genbank ( http: / / www.ncbi.nlm.nih.gov / sites / entrez? cmd=Retrieve&db=nucleotide&dopt=GenBank& list_uids=57619323 ,and http: / / www.ncbi.nlm.nih.gov / sites / entrez? cmd=Retrieve& db=nucleotide&dopt=GenBank&list_uids=1365 ), design and synthesize the whole gene SEQ ID NO: 1, containing the known linker sequence (Linker 1): ggatccggct ccaacgccac cggctccggc tccaacgccacctccggctc cactag sequence (J Clin Endocrinol Metab, 2004, 89:5204-5212).

[0026] 2. Construction of expression plasmids: the double-stranded SEQ ID NO 1 and pcDNA3.1 (+) plasmids were respectively subjected to double enzyme digestion (NheI and EcoRI), separated by 1% agar electrophoresis, and extracted. The SEQ ID NO 1 and pcDNA3.1(+) plasmids treated with double digestion were ligated by ligase. By standard CaCl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a veterinary follicle-stimulating hormone analogue and a preparation method thereof. A connecting sequence is designed according to length, foldability, hydrophobicity and charge effect of a connecting sequence between an alpha peptide chain and a beta peptide chain, the corresponding nucleotide sequence of the connecting sequence is any one of SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19 and SEQ ID NO:20, and respective expression quantity and biological activity are compared by virtue of the study. A fused protein of the prepared veterinary follicle-stimulating hormone analogue is similar to the known fused protein in term of biological functions, the expression quantity of multiple fused proteins is obviously increased, the veterinary follicle-stimulating hormone analogue can be used for replacing natural ovarian-stimulating hormone, has great commercial value and is worthy of wide-range popularization.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to a method for preparing a veterinary follicle stimulating hormone analogue. Background technique [0002] Follicle-stimulating hormone (FSH) is a glycoprotein hormone synthesized and secreted by basophilic cells of the anterior pituitary gland of animals. keys are connected. It can promote the secretion of estrogen, induce estrus in animals, promote the maturation of follicle eggs, superovulation and stimulate sperm production. [0003] At present, FSH for veterinary use is all animal brain tissue extracts, not only doped with different levels of luteinizing hormone, resulting in unstable super-expelling effect, but also has the potential risk of carrying biologically derived infectious agents. The development of veterinary FSH through genetic engineering is a current research hotspot. There are two main genetic engineering strategies for gene recombination of FSH that have b...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/66C12N15/70C12P21/02C07K14/59A61K38/24A61P15/08
Inventor 林俊生刁勇
Owner 林静静