A kind of preparation method of veterinary follicle stimulating hormone analogue
A follicle-stimulating hormone and analogue technology, applied in the field of genetic engineering, can solve problems such as not fully considering the influence of connection sequences, and achieve significant commercial value, increased expression, and good substitution effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Construction of expression plasmids and establishment of engineered cells
[0025] 1. According to the amino acid sequence and nucleotide sequence of natural sheep FSH recorded on Genbank ( http: / / www.ncbi.nlm.nih.gov / sites / entrez? cmd=Retrieve&db=nucleotide&dopt=GenBank& list_uids=57619323 ,and http: / / www.ncbi.nlm.nih.gov / sites / entrez? cmd=Retrieve& db=nucleotide&dopt=GenBank&list_uids=1365 ), design and synthesize the whole gene SEQ ID NO: 1, containing the known linker sequence (Linker 1): ggatccggct ccaacgccac cggctccggc tccaacgccacctccggctc cactag sequence (J Clin Endocrinol Metab, 2004, 89:5204-5212).
[0026] 2. Construction of expression plasmids: the double-stranded SEQ ID NO 1 and pcDNA3.1 (+) plasmids were respectively subjected to double enzyme digestion (NheI and EcoRI), separated by 1% agar electrophoresis, and extracted. The SEQ ID NO 1 and pcDNA3.1(+) plasmids treated with double digestion were ligated by ligase. By standard CaCl ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


