Special SSR primer and method for identifying purity of aromatic green dwarf seedlings
An identification method and coconut technology are applied in the identified specific SSR primers and the identification field, and can solve the problems such as the inability to guarantee the purity of seedlings out of the garden, affecting the enthusiasm of perfume coconuts, affecting the promotion work of perfumed coconuts and the like.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] The specific SSR primer sequences used for the identification of the purity of the perfume coconut seedlings are: the left primer sequence is (5'to3')TGAAAACAAAGATAGATGTCAG, and the right primer sequence is (5'to3')GAAGATGCTTTGATATGGAAC.
[0023] A method for identifying the purity of perfume coconut seedlings, comprising the following steps:
[0024] (1) The extraction of DNA of perfumed coconut seedling leaves refers to the CTAB method, and the specific operations are:
[0025] Take the leaves of Perfume coconut seedlings, add liquid nitrogen to the grinding body, quickly grind them into powder, add buffer to centrifuge, discard the supernatant, and repeat the operation once; after adding lysis buffer to water bath, add chloroform: isoamyl alcohol extract , extracted twice and then centrifuged; take the supernatant, add sodium acetate and frozen isopropanol, shake slowly until the flocculent aggregate precipitates; hook out the precipitate, add 75% alcohol to wash, ad...
Embodiment 2
[0030] The specific SSR primer sequences used for the identification of the purity of the perfume coconut seedlings are: the left primer sequence is (5'to3')TGAAAACAAAGATAGATGTCAG, and the right primer sequence is (5'to3')GAAGATGCTTTGATATGGAAC.
[0031] A method for identifying the purity of perfume coconut seedlings, comprising the following steps:
[0032] (1) The extraction of DNA of perfumed coconut seedling leaves refers to the CTAB method, and the specific operations are:
[0033] Take the leaves of Perfume coconut seedlings, add liquid nitrogen to the grinding body, quickly grind them into powder, add buffer to centrifuge, discard the supernatant, and repeat the operation once; add lysis buffer and chloroform: isoamyl alcohol extract according to the procedure, After extraction for 2 times, centrifuge; take the supernatant, add sodium acetate and frozen isopropanol, shake slowly until the flocculent aggregate precipitates; hook out the precipitate, add 75% alcohol to wa...
Embodiment 3
[0038] The specific SSR primer sequences used for the identification of the purity of the perfume coconut seedlings are: the left primer sequence is (5'to3')TGAAAACAAAGATAGATGTCAG, and the right primer sequence is (5'to3')GAAGATGCTTTGATATGGAAC.
[0039] A method for identifying the purity of perfume coconut seedlings, comprising the following steps:
[0040] (1) The extraction of DNA of perfumed coconut seedling leaves adopts the improved CTAB method, and the specific operations are:
[0041]Take the leaves of Perfume coconut seedlings, add liquid nitrogen to the grinding body, quickly grind them into powder, add buffer to centrifuge, discard the supernatant, and repeat the operation once; add lysis buffer and chloroform: isoamyl alcohol extract according to the procedure, After extraction for 2 times, centrifuge; take the supernatant, add sodium acetate and frozen isopropanol, shake slowly until the flocculent aggregate precipitates; hook out the precipitate, add 75% alcohol ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
