Unlock instant, AI-driven research and patent intelligence for your innovation.

Special SSR primer and method for identifying purity of aromatic green dwarf seedlings

An identification method and coconut technology are applied in the identified specific SSR primers and the identification field, and can solve the problems such as the inability to guarantee the purity of seedlings out of the garden, affecting the enthusiasm of perfume coconuts, affecting the promotion work of perfumed coconuts and the like.

Active Publication Date: 2015-04-01
COCONUT RES INST OF CHINESE ACAD OF TROPICAL AGRI SCI
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In this way, it is bound to cause a lot of waste of manpower, material resources and financial resources.
At the same time, because the purity of the seedlings out of the nursery cannot be guaranteed, it seriously affects the recognition of the majority of growers on the perfumed coconut and the enthusiasm for planting, which in turn affects the large-scale promotion of the perfumed coconut.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Special SSR primer and method for identifying purity of aromatic green dwarf seedlings
  • Special SSR primer and method for identifying purity of aromatic green dwarf seedlings

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] The specific SSR primer sequences used for the identification of the purity of the perfume coconut seedlings are: the left primer sequence is (5'to3')TGAAAACAAAGATAGATGTCAG, and the right primer sequence is (5'to3')GAAGATGCTTTGATATGGAAC.

[0023] A method for identifying the purity of perfume coconut seedlings, comprising the following steps:

[0024] (1) The extraction of DNA of perfumed coconut seedling leaves refers to the CTAB method, and the specific operations are:

[0025] Take the leaves of Perfume coconut seedlings, add liquid nitrogen to the grinding body, quickly grind them into powder, add buffer to centrifuge, discard the supernatant, and repeat the operation once; after adding lysis buffer to water bath, add chloroform: isoamyl alcohol extract , extracted twice and then centrifuged; take the supernatant, add sodium acetate and frozen isopropanol, shake slowly until the flocculent aggregate precipitates; hook out the precipitate, add 75% alcohol to wash, ad...

Embodiment 2

[0030] The specific SSR primer sequences used for the identification of the purity of the perfume coconut seedlings are: the left primer sequence is (5'to3')TGAAAACAAAGATAGATGTCAG, and the right primer sequence is (5'to3')GAAGATGCTTTGATATGGAAC.

[0031] A method for identifying the purity of perfume coconut seedlings, comprising the following steps:

[0032] (1) The extraction of DNA of perfumed coconut seedling leaves refers to the CTAB method, and the specific operations are:

[0033] Take the leaves of Perfume coconut seedlings, add liquid nitrogen to the grinding body, quickly grind them into powder, add buffer to centrifuge, discard the supernatant, and repeat the operation once; add lysis buffer and chloroform: isoamyl alcohol extract according to the procedure, After extraction for 2 times, centrifuge; take the supernatant, add sodium acetate and frozen isopropanol, shake slowly until the flocculent aggregate precipitates; hook out the precipitate, add 75% alcohol to wa...

Embodiment 3

[0038] The specific SSR primer sequences used for the identification of the purity of the perfume coconut seedlings are: the left primer sequence is (5'to3')TGAAAACAAAGATAGATGTCAG, and the right primer sequence is (5'to3')GAAGATGCTTTGATATGGAAC.

[0039] A method for identifying the purity of perfume coconut seedlings, comprising the following steps:

[0040] (1) The extraction of DNA of perfumed coconut seedling leaves adopts the improved CTAB method, and the specific operations are:

[0041]Take the leaves of Perfume coconut seedlings, add liquid nitrogen to the grinding body, quickly grind them into powder, add buffer to centrifuge, discard the supernatant, and repeat the operation once; add lysis buffer and chloroform: isoamyl alcohol extract according to the procedure, After extraction for 2 times, centrifuge; take the supernatant, add sodium acetate and frozen isopropanol, shake slowly until the flocculent aggregate precipitates; hook out the precipitate, add 75% alcohol ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of aromatic green dwarf seedling cultivation and discloses a special SSR primer and a method for identifying purity of aromatic green dwarf seedlings. The method comprises the following steps: firstly, extracting DNA of aromatic green dwarf seedlings, performing PCR amplification by virtue of the special SSR primer, enabling amplification products to be subjected to a polyacrylamide gel electrophoresis to separate stripes, and dyeing, thereby distinguishing the aromatic green dwarf seedling capable of bearing aromatic coconuts from the aromatic green dwarf seedling incapable of bearing aromatic coconuts according to the separated stripe condition. The method for identifying purity of aromatic green dwarf seedlings disclosed by the invention can be used for accurately identifying the aromatic green dwarf seedling capable of bearing aromatic coconuts during a seedling stage without waiting for coconut trees to bear fruits, is high in identifying accuracy rate and capable of ensuring the purity of aromatic green dwarf seedlings, has great economic benefits and great practical significance in popularizing the aromatic green dwarf.

Description

technical field [0001] The invention relates to the technical field of cultivation of perfumed coconut seedlings, in particular to a specific SSR primer and an identification method for identifying the purity of perfumed coconut seedlings. Background technique [0002] Perfume coconut is an excellent new variety of coconut introduced from Thailand in recent years. Its main feature is that the coconut meat and coconut juice have a glutinous rice fragrance that can be smelled by the sense of smell. The leaves of plants with obvious fragrance can also be smelled faintly after rubbing with fingers. The aroma of glutinous rice is very popular among consumers. At the same time, the output of perfumed coconut is high, the production is early, the market value of fresh fruit is high, and the economic value is much higher than that of Hainan's local coconut varieties. [0003] The pollination form of perfumed coconut is mainly self-pollination, but there are also pollination by medi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/156
Inventor 杨耀东吴翼沈雁肖勇夏薇李静周立霞
Owner COCONUT RES INST OF CHINESE ACAD OF TROPICAL AGRI SCI