Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker
A technology of epsilon cyclase and tobacco products, applied in the field of molecular biology research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] A method for identifying tobacco products with a lycopene epsilon cyclase gene ILP marker, comprising the steps of:
[0025] 1. ILP primer design:
[0026] Using the gene sequence information of lycopene epsilon cyclase and comparing the gene sequences of multiple species, the conserved primers spanning the second intron were designed. The sequences of the upstream and downstream primers are CTGATGTGTTGCTGTGCTAGG and AATGCACTTCGCAAGCTCTA, respectively.
[0027] 2. Extract the DNA of the sample to be tested:
[0028] 1) Take the sample to be tested (ie figure 1 The shredded tobacco involved in the case 1) Grind into a fine powder and put it into a 2 mL centrifuge tube;
[0029] 2) Add 600 μL of CTAB extraction buffer at 60°C, mix well, shake gently every 3 minutes, centrifuge at 12000 r / min for 10 minutes after 20 minutes;
[0030] 3) Aspirate the supernatant carefully, add phenol and chloroform (each 400 μL) with the same volume as the supernatant, mix well, and cen...
Embodiment 2
[0036] A method for identifying tobacco products with a lycopene epsilon cyclase gene ILP marker, comprising the steps of:
[0037] 1. ILP primer design:
[0038] Using the gene sequence information of lycopene epsilon cyclase and comparing the gene sequences of multiple species, the conserved primers spanning the second intron were designed. The sequences of the upstream and downstream primers are CTGATGTGTTGCTGTGCTAGG and AATGCACTTCGCAAGCTCTA, respectively.
[0039] 2. Extract the DNA of the sample to be tested:
[0040] 1) Take the sample to be tested (ie figure 1 The shredded tobacco involved in the case 2) was ground into a fine powder and put into a 2 mL centrifuge tube;
[0041] 2) Add 800 μL of CTAB extraction buffer at 60°C, mix well, shake gently every 5 minutes, centrifuge at 12000 r / min for 15 minutes after 20 minutes;
[0042] 3) Aspirate the supernatant carefully, add phenol and chloroform (each 400 μL) with the same volume as the supernatant, mix well, and c...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
