Check patentability & draft patents in minutes with Patsnap Eureka AI!

Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker

A technology of epsilon cyclase and tobacco products, applied in the field of molecular biology research

Active Publication Date: 2015-04-29
CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Table 1 lists the application of DNA molecular marker technology in various types of identification. At present, there is no relevant report on the use of DNA molecular marker technology to identify tobacco products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker
  • Method for identifying tobacco product by using lycopene epsilon cyclase gene ILP marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] A method for identifying tobacco products with a lycopene epsilon cyclase gene ILP marker, comprising the steps of:

[0025] 1. ILP primer design:

[0026] Using the gene sequence information of lycopene epsilon cyclase and comparing the gene sequences of multiple species, the conserved primers spanning the second intron were designed. The sequences of the upstream and downstream primers are CTGATGTGTTGCTGTGCTAGG and AATGCACTTCGCAAGCTCTA, respectively.

[0027] 2. Extract the DNA of the sample to be tested:

[0028] 1) Take the sample to be tested (ie figure 1 The shredded tobacco involved in the case 1) Grind into a fine powder and put it into a 2 mL centrifuge tube;

[0029] 2) Add 600 μL of CTAB extraction buffer at 60°C, mix well, shake gently every 3 minutes, centrifuge at 12000 r / min for 10 minutes after 20 minutes;

[0030] 3) Aspirate the supernatant carefully, add phenol and chloroform (each 400 μL) with the same volume as the supernatant, mix well, and cen...

Embodiment 2

[0036] A method for identifying tobacco products with a lycopene epsilon cyclase gene ILP marker, comprising the steps of:

[0037] 1. ILP primer design:

[0038] Using the gene sequence information of lycopene epsilon cyclase and comparing the gene sequences of multiple species, the conserved primers spanning the second intron were designed. The sequences of the upstream and downstream primers are CTGATGTGTTGCTGTGCTAGG and AATGCACTTCGCAAGCTCTA, respectively.

[0039] 2. Extract the DNA of the sample to be tested:

[0040] 1) Take the sample to be tested (ie figure 1 The shredded tobacco involved in the case 2) was ground into a fine powder and put into a 2 mL centrifuge tube;

[0041] 2) Add 800 μL of CTAB extraction buffer at 60°C, mix well, shake gently every 5 minutes, centrifuge at 12000 r / min for 15 minutes after 20 minutes;

[0042] 3) Aspirate the supernatant carefully, add phenol and chloroform (each 400 μL) with the same volume as the supernatant, mix well, and c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of research of molecular biology, and in particular relates to a method for identifying a tobacco product by using a lycopene epsilon cyclase gene ILP marker. The method disclosed by the invention comprises the following steps: extracting DNA (Deoxyribonucleic Acid) of a sample to be detected by using a cetyl trimethyl ammonium bromide (CTAB) method; and carrying out PCR (Polymerase Chain Reaction) amplified reaction by taking CTGATGTGTTGCTGTGCTAGG and AATGCACTTCGCAAGCTCTA as upstream and downstream primers respectively, detecting an amplified product through gel electrophoresis after reaction, and judging that the sample is the tobacco product if electrophoretic bands exist at the positions of 450bp and 550bp. Compared with the traditional identification method, the method disclosed by the invention has the advantages of being more objective, more accurate, more reliable and the like.

Description

technical field [0001] The invention belongs to the field of molecular biology research, and in particular relates to a method for identifying tobacco products using lycopene epsilon cyclase gene ILP markers, which uses the specificity of tobacco species DNA as the identification basis, compared with traditional identification methods , which has the advantage of being more objective, more accurate and more reliable. Background technique [0002] Tobacco is difficult to identify from the appearance, but there are the following limitations in the detection of tobacco-specific chemical components such as nitrosamines and nicotine: First, nicotine is not unique to tobacco, and it is not unique to tobacco. It is also very common in plants; secondly, it is easily disturbed by means such as illegal feeding of criminals. In addition, the above-mentioned regulations require inspectors not only to master relevant raw material characteristics, chemical composition analysis methods, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/156
Inventor 刘楠张威罗安娜何声宝王英元冯晓民胡清源邢军
Owner CHINA NAT TOBACCO QUALITY SUPERVISION & TEST CENT
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More