Check patentability & draft patents in minutes with Patsnap Eureka AI!

Primer, kit and detection method for detecting 245bp deletion alternative spliceosome of LEPR gene

A splicing body and kit technology, applied in biochemical equipment and methods, microbial measurement/testing, DNA/RNA fragments, etc., can solve problems such as low accuracy, cumbersome procedures, and long time consumption, and achieve strong applicability Effect

Active Publication Date: 2015-06-03
HENAN AGRICULTURAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] In view of the above situation, in order to overcome the defects of the prior art, the purpose of the present invention is to provide a method for detecting the alternative splicing of LEPR gene 245bp deletion The primers for the body and the kits and detection methods containing the primers can effectively solve the problems of cumbersome procedures, long time-consuming and low accuracy of the existing detection methods

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer, kit and detection method for detecting 245bp deletion alternative spliceosome of LEPR gene
  • Primer, kit and detection method for detecting 245bp deletion alternative spliceosome of LEPR gene
  • Primer, kit and detection method for detecting 245bp deletion alternative spliceosome of LEPR gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The specific implementation of the present invention will be described in detail below in conjunction with the accompanying drawings and examples.

[0024] Depend on figure 1 As shown, the present invention is realized by the following technical solutions in specific implementation.

[0025] one for testing LEPR Primers for gene 245bp deletion alternative splice body, including primer pair P and primer pair ACTB,

[0026] The primer pair P is:

[0027] Upstream primer, P-F: 5'-TCCCTACCAAGATGCTGAC -3';

[0028] Downstream primer, P-R: 5'-TTGCTCGCGATCGTTCACA-3';

[0029] Described primer pair ACTB is:

[0030] Upstream primer, ACTB-F: 5'- GAGAGAAGATGACACAGAC -3';

[0031] Downstream primer, ACTB-R: 5'- GTCCATCACAATACCAGTGG -3'.

[0032] The primer is effectively used for preparing a kit for detecting the 245bp deletion alternative splicing body of the LEPR gene.

[0033] one for testing LEPR A test kit for gene 245bp deletion alternative splice body, said te...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a primer, a kit comprising the primer and a detection method for detecting a 245bp deletion alternative spliceosome of an LEPR gene and aims at solving the problems of tedious program, long consumed time and low accuracy. The detection method comprises the following steps: with cDNA as a tempelate and a primer pair ACTB as a primer, and amplifying an ACTB reference gene by virtue of real-time fluorescence quantitative PCR; with a primer pair P as a primer, carrying out real-time fluorescence quantitative PCR amplification, wherein the reaction system of the real-time fluorescence quantitative PCR amplification consists of 2*SYBR@Premix Ex TaqTMII, ultrapure water with RNase removed, a primer P-F or ACTB-F, a primer P-R or ACTB-R, and the cDNA tempelate, and the reaction method comprises the following steps: initial denaturation, denaturation, annealing and extension; and analyzing a qPCR real-time monitoring result, calculating by using 2-delta CT relative quantification, and carrying out difference significance test by SPSS version 20.0. The primer, the kit and the detection method are accurate, rapid and convenient and strong in applicability.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a method for detecting LEPR A primer for a gene 245bp deletion alternative splice body, and a kit and detection method comprising the primer. Background technique [0002] Leptin is mainly a small peptide hormone secreted by the white adipose tissue of non-avian vertebrates, which binds to the leptin receptor (LEPR) to exert its biological function. However, functional studies of LEPR are limited due to the lack of avian endogenous Leptin. Recently, birds Leptin The successful cloning of the gene has pushed the research of bird Leptin and LEPR to a new climax. birds LEPR The widespread expression characteristics of gene organization have been proved, but the identification and isolation of multiple alternative splicing forms are relatively slow, which will hinder the LEPR The study of the physiological function of genes. Therefore, it is of great significance to use molecular ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6858C12Q2561/113C12Q2563/107C12Q2545/101
Inventor 刘小军王丹丹徐春林李转见王台安蒋瑞瑞闫峰宾康相涛
Owner HENAN AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More