Adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and preparation method thereof

A technology of fusion protein and genetic recombination, which can be applied in the direction of drug combination, peptide/protein components, chemical instruments and methods, etc., and can solve the problems of poor prognosis

Active Publication Date: 2015-07-15
浓孚雨医药河北有限公司
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have found that EpCAM is overexpressed in colorectal cancer and breast cancer, and it is closely related to tumor growth, metastasis and malignancy. The prognosis of tumor patients with EpCAM overexpression is significantly worse

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and preparation method thereof
  • Adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and preparation method thereof
  • Adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0147] 1. Experimental materials

[0148] 1.1 Plasmid:

[0149] Plasmid pORFhGM-CSF was purchased from Invivogen; plasmid pET-30a was purchased from Novagen.

[0150] 1.2 Main reagents:

[0151] Plasmid extraction kits and gel recovery kits were purchased from Shanghai Sangong; Ni SepharoseTM 6Fast Flow was purchased from GE.

[0152] 2. Experimental method:

[0153] 2.1 Construction of recombinant EpCAM-GM-CSF fusion protein expression plasmid

[0154] 2.1.1 Design and synthesis of primers:

[0155] According to the restriction site of plasmid pET-30a, the EpCAM gene sequence provided by NCBI, and the gene sequence provided by plasmid pORFhGM-CSF, the upstream and downstream primers of EpCAM and hGM-CSF genes were designed respectively:

[0156] The sequence of the upstream primer of EpCAM is: 5'CATGCCATGGgcATGGCGCCCCCGCAGGT3'; the sequence of the downstream primer is: 5'ACGCGTCGACTGCATTGAGTTCCCTATGCATC 3'; the upstream and downstream primers respectively introduce restr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to adenocarcinoma specificity EpCAM-GM-CSF genetic recombinant fusion protein and a preparation method thereof. The method comprises the first step of designing and compositing a primer, the second step of amplifying and sequencing genes, the third step of constructing a recombinant vector pET-EpCAM-hGM-CSF, the fourth step of screening and identifying the recombinant vector pET-EpCAM-hGM-CSF, the fifth step of recombining plasmid pET-EpCAM-hGM-CSF to transform escherichia coli Rosetta, the sixth step of recombining EpCAM-hGM-CSF fusion protein to induce to express in escherichia coli Rosetta, the seventh step of purifying the EpCAM-hGM-CSF fusion protein, and the eighth step of permeating and concentrating the purified EpCAM-hGM-CSF fusion protein.

Description

Technical field: [0001] The present invention relates to the preparation of a gene recombinant protein, in particular to a preparation method of an adenocarcinoma-specific EpCAM-GM-CSF gene recombinant fusion protein Background technique: [0002] Cellular immunotherapy of tumors has been widely used clinically, and there are dozens of clinical trials of therapeutic DC (Dendritic cell, DC) vaccines registered in the United States. There are many kinds of tumor antigens used, including tumor cell lysates, tumor cell fusions, tumor RNA, tumor DNA, tumor-associated whole antigens, protein polypeptides, protein single peptides, etc. In clinical practice, tumor cell lysates are often used as antigens to prepare DC Vaccines that induce antigen-specific cellular immune killing. However, due to the immunosuppressive effect of the tumor microenvironment and other reasons, the objective effective rate of DC vaccine is not satisfactory. Therefore, how to break tumor immune tolerance ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K19/00C12N15/70C12N15/62A61K38/19A61K39/00A61P35/00
Inventor蔡建辉
Owner浓孚雨医药河北有限公司